Oryctolagus_cuniculus Locus Mono:201:SNORA2
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:201:SNORA2
Oryctolagus_cuniculus
Mono:201:SNORA2
GeneScaffold_1548
SNORA2
1001..1136
2136
AAGTGTGAAAGCTTTGAAGAACCAGATGGCAGGTTTCTGTTTCTCCAGGAGCCAGTGAC
AGGGAAAGAGCTCCAGGTCAGGAACAGCCTGAACTGAGCCATGATATAGGGAACCTGATC
TAGCAGCCTTGTGGAGGAGAGATTAGAAACGAGAAAGATCGTGCGCAGATGCACACATTT
TTGTGCTAACAACCCAGGAAAATAAATGAGTCCCGAATTCACGGGGGCGACACTGAATGG
AGGAGAGAGGCCCATGTTGGGGAGACATCACAGAGGGAGAAGTGGTGTGAATTGGTCACA
CGGGCTGAACTGTGGCTTCAATTTCTGAGGCAGGGGTGACAGAAATAAAGCCATCTGAGG
CGCGATGCCTGAGAAAAGGTCCCTGATTCGCTAGCGCAGTCTCATATAGCAGTTCCTGTT
GAATGACTCCCTTCCATGCTAACTGCAAAGCAGTGAGGAGTNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNAGGCGCTGTTGGTGGTGACTAGGGACATGGCCTGATTAA
AGGAAGGTGGACTCTGGGATTGGGAGTCAGTGCACACTTCAGTCAAAAAGGGGGCCCCTC
TGAATCTCAGTAGATGATGGGATCATTGGGCCAAAATGTTATTATTCAAGCCAAAATCAA
TGAAAGTTCTGGGCTCCTTTTCAGTGGATGGCACAGAAATAGTTGTACCTTTAAAAGTCA
AAAGTGATTTGCAGAAATTGCTGTGTGATACAATGGAATAGTGCATGATAAAAACTGAAA
TAAAATACCATTTTCACATTTTTACTAATGTGGCAAATAATCGCTACTAAGCTACCAACT
CATCTTTGATCATAACTGTGTTGTCACTGTTTTAAGTCATTGAGAAATTTTTTTGTAAAT
GACAAGGCAAAGTTTCAGCAATCTTTAATATCCGTTTTATATTGGCCCTGAATCAAGACC
AGTAGTTTGCTGAAGCTGTTGGTTTCAAGCAGGAGTCTAAAGAAATGCCTTTCCATGGTC
TGTTGACCATTTCAGAACTTCAGAAATATAATGTCACTTCATTTGGAAGAAACACCAGAG
TTGTCTTATTAAAAAAATCCATTTTATGTATTTCCATGGGCTGAAAATTTATTACGCAGT
CAACCTACAGTGCCCTGGCACCAAAACAAACAAACAAACAAACAAAACACAAATATTCTA
GAGAGACTGATTCCAGAAAAAAAAATGGAGTATTATGTAAAAACCGCCATGTTTTTGCTT
ATAAACCACTGTAGTGTAGTAATACTCATTGAAGGCTTTGTGCAAATATGGTTGCCCCCC
CACCAGATTATCACTGCTTTTAGTGACTACAGACACAGCCAGAGTAGAATTTGCTTGCAT
AAAAGATTTCACTCACCAATAGTATAGACAAAGCCCAAATATAGCAGTTGATAACATGAA
ATTAAAACAATGGTACTACAGTCATCTCTTTCCAGTACAAAAACTGATGACTTTTGCACT
TTTTTAATACATTTTTTATTCATATAAGGTGAACATATTTCATATATTTCATATATATTT
AGGAGTATAGTGATGACTTTTGCACCTTATCTTCACTACACTTACTGTTCTGGGGAGAAG
AATAATGACTTCCAGAACATTCCATATTTGACACTGGACCTTGGTAAAGTTAATTAGCCT
CTTCTAAAGTCATTTTCACATCATTATGGAGGAGATGAAATGCCTACTTAGTGAGAAAGG
TGTTGAGAGAGTTGGAAATAACACACACAATGTCCCTGGTACATAGCGGGTGCTCAAGTA
CACAACTATAACTCTGGTCTTGCCGGTGATACTGCAGAAAGATCATTACCACGGCCTGGC
ATTGTGGCACAGCGGGTAAAAGCCACCTCATGCAATGCCAGCATCCCATATGGGCACCGT
TTCATGTCCCAGCTCCACTTCTGATCCAGCTCCCTGCTAGTGGCCTGGGAAAAGCAGCAG
AAGATGACTCAAGTAGTTGGGCCCCTGCTACCCACGTGGGAGACCCGGAAGAAGCGCCTG
GATCCTGGCTTCAGCCTGGCCCAGTTCTGGCCATTGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved