Oryctolagus_cuniculus Locus Mono:8:SNORA25
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:8:SNORA25
Oryctolagus_cuniculus
Mono:8:SNORA25
scaffold_210403
SNORA25
1001..1123
2123
CTCTGGCACTCTGGCATAGAGCATGGGCTCTTAAAAGCTAAATCACATGCCCATACCTC
TTTGACTTCTTTAATGCGACTACTAGAACATTTACAATTATACAAGTGGCTTATATCATG
TTTCTATTGTTTGAGAATCTAACAAATAAATTCTTACTATCAAATGGAGAAAAATAATGT
ACATATATACAAATTACTACATATAGAAAGTAAAAAAGAATAAAACACTAATAACTTTCT
GCTGGATTATAATAGGTGAAATACACAACTGATTTGGAGAATAATAAAAGCTGCAAGTAG
AAGCTGCTGACAGTTTTGCCCTATAAGTACACAGAATAGTCATAGACAATAATGGCTTCA
ACTTTTCAAAAGTAAGCCCCTGGGGCTGGCATTGTGACACAGTGGGTTAAGTTGCCACAT
ATAACAACAGCATCCCATATTGAGTCCTGGCTGCTCTGTTTCTGATACAATTCCCTACTA
ATGCCCCTGGAAGGCAGTGGAGGACAGCCCAAGTGCTTAGGCCCAACACCCATTTGGGAG
ACCTGGATGGAGTTCCTGGCTCCCTGTTGCTGCCTGATCCCGCTCTGACTGTTGTAGCCT
TTTGGGGAGTGAACCAGTAGATGGAAGATCTCTCTCTCTCTTTTTCTCTCCTTTTCTGTC
ACACTACTTTTCAAATATATAAAAGTATCTTTAAAAAGAAAAAGTAAACCCAGGTTCCTT
AAAAAGGAATACAGAAATACTAGTCTATGAAAGAGTAATTCTACTCTTAGGTGTAATACC
CAGAGCCATTAAAAGGAGGAATTTGAACAGATATACTTTTCTGTCAATATTCCTCTAGCT
TAATTCACATAGCCAAAAGGTCAAACAGATCAAGTGTCTATCAACAGATGAGTGGATACT
GAAATGTGTTACAAGTCTAAAATGGAATATTATTTAGATAAGAAAAATGAAGTTCTGATA
CATGCCACACCATGGCTGAAACTTAAAAGCATTATGCTAATAGGTCACTTTAAAGAGGGT
TTCTGAGCTGCAAAACCAAGACCTTTAAATGCTATGAACAAAGACTGAAGTTCTCCACAG
GATATCAGTCACACAATACTGTGTTTTCCTGAGGAGAGATAAGATTCAGTCACTCATAAT
CATGACATAATCCATGACTGGTGATATAGGAAAGTAATACATGTTTGAAAGTCTTAAAAA
AAAAAAAAAAACTAGGCCGGCGCCGCGGCTCACTAGGCTAATCCTCTGCCTAGCGGCGCC
GGCATACCGGGTTCTAGTCCCGGTCGGGGCACCGGATTCTGTCCCGGTTGCCCCTCTTCC
AGGCCAGCTCTCTGCTGTGGCCAGGGAGTGCAGTGGCGGATGGCCCAAGTCCTTGGGCCC
TGCACCCCATGGGAGACCAGGAGAAGCACCTGGCTCCTGCCATCGGATCAGCGCAGTGCG
CCGGCCGCGGTGCGCCGGCCGCAGCGCGCCGGCTGCGGCGGCCATTGGAGGGTGAACCAA
TGGCAAAGGAAGACCTTTCTCTCTGTCTCTCTCTCTCACTGTCCACTCTGCCTGTCAAAA
AAAAAAAAACAAAAACAAAAACAAAAAAAACCTAATTTTTTCTTTCAAGCCCCATTTATC
CATTAGGACAAAACTAAAAACATTATGCTAACTGAAATAAGACACTAAAGGTCAAATATT
ATGATTCTGATATCTGAAACAGCCAAATGTATAGACAGAAGAGAGATCAGAGGCTTTCCT
GGGCTAAGGGGAAGGCAGAATGGAGAATTATTTAAAAGGTAGAGTTTCTTGTATGGAGTG
GTGAAAAAATTTTAGAAATAGTGATTACCATGGCTGTACAACATTAAGAATGTACTTAAT
TCAACTGAACCATATATTTAAAGATAGTTACAATGGCAACTTTTTATATATATATATAAT
ATGCATTTTACTACAACTTAACAAAATTAGTTATACACTAAATACTGAACTGTACACTTT
AATTGTGTATGGCATGTGAATTATATCTCAATAAAGCTGTTTTAAAAAAGTAACCCAAGG
GGCCAGCGCTGTGGTGTAGGTTAAAGCCCTGGCCTGAAGCGCTGGCATCCCATATGGGCG
CTGGTTCTAGTCCCGGCTTCTCCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved