Oryctolagus_cuniculus Locus Mono:177:SNORA19
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:177:SNORA19
Oryctolagus_cuniculus
Mono:177:SNORA19
GeneScaffold_2293
SNORA19
1001..1125
2125
TCCCCTAATGGGAGTCCAACAGCCAGGACAGGGCCAGGAGGAAGCCAGGAGCCGTGAGC
TTCTTCTGGGTCTCCCACGTGGGTGCAGGGGTCCAAGCACTTGGTCCATCTTCCGCTGCT
TTCCCAGGCCATTAGCAGGAGCTGGATGGAAAATGGAGCAGCTAGGATTTGAACCAGTGC
TCATATGAGATGCTGGTGTTGCAGATGGTAGCTTAACCCACTATGCCACAACCTTTTTCA
GGTTTTTTCAAAACTTTCTACAATGAACATCTACACTACAGTTTGAAAGAGTTACAAATA
CAATAAAATTCTTAACTCTCTTTACTCAGTTTCAAAAACTTTAAACTACCTAGTTAATAA
GAGGTATGAGAACAAACAACACATGAAAATCATTTATTTGACTAAGTCTCAAAATAAAAA
TTTTAACTTACATAAAATAGCCATGTAGCAATTCTATTTCCTGTCCCCAGCTCTTTGAAA
GCATCTGGTTCATCTTTCTGTGAATAAAACACAGCAAATTCAATGGTTTAAAATTTAGCA
ATATAAATTGTCTAGTGGCAACAAAACATCCGTAGTAATATGCTAAAGAATATGCAAAAA
ATAACCCCCAAAAGTTCCCCAATAATGTCATGTGCACTATTTACATCAGGCACTCAAATG
CTTATTGATTACTGGGTCAGTATATATACTAGATAATTTTGACAAGACCAGGGCAGGGAA
ATTATTTGAGAGCGAGTACCTATTAACTGCATATAAGAAATCAAAACATATAGTTTTAGT
TTCCAGGATAATAAGACATCAGAGCCACTTCTTAGCTATATTCATGAAACTTACTCCCTA
TGGGTAAAACAACATGAGATTTATTTTCAACTAATGACCCACTCAAACATTAACTGCTAT
TACGGTTGTCATTCTTTTAGACATCACTTTAATTAGCCTGGAAAATTCATTTTTAGTTAT
ATAAATCTTAATTTTAAAAAGCTATATAATCTCTTAGCATACTGCACATTTCATTGTCCT
GCTTTCTTTGTATGTGTGAACAGTATTATTTCTTATGTGCTATACAAAGAGTTGAAGGTT
AATTAGCAGAATAGGTAGTAATGCTGCCAGTCTCTTTAAGACAGACACCACATAATCTCT
TAACATGTATCCCAGAAAAATGAAATCATATTTTTCACATGGAAATTTATATACATCTTT
ATTTTTAAATAACAGAAAAGCATCCAGAGCATCCTTCAAAGAGTAATGTCTAAACTGGTA
AATCCATACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved