Oryctolagus_cuniculus Locus Mono:103:snoZ39
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:103:snoZ39
Oryctolagus_cuniculus
Mono:103:snoZ39
scaffold_122108
snoZ39
1001..1063
2063
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNCTAATTTGTGAAAACTCCCAAGAGATTTTTAAGAAAAAAAGTTTCTAGTGCT
GGTGGAGTTAGTCTCCTATGATGCTAGAATTATTAATAGTCTGTGCCTGATCAGCTCAGC
CAATTTGGGAAAAGTTAAAGCTTCTGAAGATGGAGGCATTGGTTTTGAAGGATAATGGTT
TCACAGCACCATAGGCCATTGTCCCAACTGAGAGAATAGGAATAGGGTCCAGGTTGAGAA
AGCCTGGAGTGTGTGCCCAAAGGAGTCTTGCATATTGCGAAGAACTCATCTGTGTGTGAA
TGAGAGCTTCTTATAGGTGATTTGTGATGAGTTTCTCAGCAATGCTGTGAGAAGCTTAGT
GGGATAATTGGAATTAGTCCCAAAATATACTTCAGAAAGTTAAATTCTTTTTTTCTTAGT
TTACAAAGGGAGTGATTTATCCATCATATGGAAAGGTTTTGGTGCATATGATGAAGCAAA
TCAGTATGATTACAATCATGATACTGTAAACGCTTTCTGATGTACCAGTTAAACTGACAG
TTTATTGATAAAAGTAGATGGTTTTAAACAGGATATTTTACTGATGATTTTTGCTTTTAT
TTTGCAGATAACAGCATTTCAAGAGGTTCAGTCTCTGGAAAATGGATCAAACTCTTGAAC
TCATAGCATACTAGATATGTTTGTAAATAAACTTACGACTTGAATGCTGAATGCCTCTTC
TCATATATAGGGATTGTGATAATTGAGTGTGTGCTTGCTTTATGATTTGGATGATATTCC
AGTATTAGTTTCTTAATCAAGATGTGTATGATTCAGCTTGTTATGTGATTATCTATTTAA
TTTTTGCTCTTTTGGATTAAGACATTGTTGAAAATTGATGATATAAAAGAAATGCCAAGT
TATCTATTGTCTATAGCTTTCTTTTAAAGGGAGAGAAAAGATTTAAGAGCTTCATTTTTT
TCTCAGGCCTATAGCATTAAAGCTGAAATTTTTGGTGTGATAATGGTACTGCTGACCAAT
AATCTTGTTGAGGCTGAATAAAAGTATTTAAAATGGAAGCATATACTGTAGGAAGTATTC
CAAACTTACTATGGAGTTTGACTAGTAGCAAGGGGATAAAAGATAACAATTGAATTATGC
TTTAAAATCTTAAGGGCCTAGTTTGTAGGGCTTTGTTTTAGGCAGGGGAAAGTAATTTGC
AATTGAATATTTTAATAGTTTGGTTGCTTCTAAAATAAGAGTGGATGAATAATGTAAAGC
AGATTATAAGCTGGTAGTCTCTCTGGCCTCCAGATTTTGGTGAGAGGATGCTATATGTTT
CTAGATAACATGTATTTCTGGATTCTTGAACAATTGCTCAGTGTGGTTCCAAATCTTTTG
ATAGAACAAAATAGGTGCCTACACAGCACTTATAATGTTAGGCATCCTCTTAGCCTTAGT
GTAAAACCACCTGATTTGCTAAAACTTGAAATTTTTATTCTCTGTTTATATGCTAGTGCC
TGTCTTTAGACTCCTTAACAGCCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved