Oryctolagus_cuniculus Locus Mono:104:SNORA25
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:104:SNORA25
Oryctolagus_cuniculus
Mono:104:SNORA25
scaffold_196488
SNORA25
1001..1129
2129
ATTGAGAAGTAAGGGAAAGGTACAAATTAATAACAGACTTTAGCTTAAGAAAAAAAATA
ATGTTATAGTAATGAAAAAGAGGCATTCCTTAGCCACAAACAATCTGGCACCAGAGTAAA
ATTGCCATATTCAAGGGCAGTATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCACTTTTGTTCTTTGTCTCCTTTCCTC
CTCTGCAAAGATATCAAAATATGCTCCTCAAACACATGTATTAAATATTTCATTTGTTCA
GTCAGTAATGAGGCACAAATGAGAAACTTATAACTCACTGCAGATCATTTCAAAGAGGGT
TTGTGGTGCTGTGAAGTCAAGAACTCTTAACTGTATGCCCAAAGATTAAAGTTCTCCATA
AGACGCAATGCTCACTCAATAATGTTACATATTCTTGAGAAGTTAGAGGATTTAGCCACC
TATAATCATGACATAAACTACGACTAGTGGAAAAGTAAATAAGCTACTCAAAATCTATAA
CAATAGATAAATAAATAAATAAATAAATCTCACTGATTAAGACTTTCAGTTTGGGAAAAT
GAAAAGGTTCTGGAGATGGTTTTTGGTAATTTCTAATGGCTGCACAACAGTGTGAATGTA
CTTAATGCCACAGAATTGTGCACCTAAAATCATTAAAATAGTAAGCTTTATGTTATGTAT
TTTTACAACAACAAAAATACTGGTAACAAGCAATGTTCACTGGAAGAAAACTGAGATAAA
ACTCTATTAAAGGGGACAGCGCCATGGCTCACTTGGTTAATCCTCCGCCTGAGGTGCCAG
CATCCCATTTGGGCACCAGGTTCTAGTCCTGGTTGCTCCTCTTCCAGTCCAGCTCTCTGC
TGTGGCCCGGAAGAGCAGTGAAGGATGGCCCAAGTGCTTGGCCCCTGCACCCGCATGGGA
GACCGGGAGGAAGCACCTGGCTCCTGGCTTCGGATCGGCATAACTCTGGCAGTAGCAGCC
ATTTGGGTGGTGAACCAACGGAAGGAAGACCTTTCTCTCTGTCTCTCTCACTGTTTAACT
CTATCTGTCAAATAAATTAAAAAAAAAAAAAAAACTATATTAAAGAGAGAAAATTCTACC
TGGGATTTCAAAGATTCATTGCATCTTTCAGATATCAAAGTTGAATGTACAGTCAGGTTT
CATCAGCAAATTAATCACCAAAAAATACAAAAATAATACTTACAATGTCTATGCAGAAGC
TCTGTCATTAAGTGCATGGATGCTCAACCAAAAGAGGGAGTGGGGATGGGGAAAGGCATA
TGTGTGTGCAACAAAAATTCTCTGAATTCCTAGATTGTAGAAGGCAATGCACTAGGTTCT
ATGGGCACAAAAAAATGAAAGCAATTCAGACATATGTCCTCAAGAAATGGCCAGGTAACA
CTTACCATCTTTAGTTCTACTTTTGGGGAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved