Oryctolagus_cuniculus Locus Mono:106:SNORA16
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:106:SNORA16
Oryctolagus_cuniculus
Mono:106:SNORA16
scaffold_183824
SNORA16
1001..1130
2130
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNAAGTTAAGGTTTAAATCCAGTCTATCTGAGGCCAAGCCCATATTCTTCTCTC
CATTCTAGCATGCTATATTCCATATGGGATTTCATAATCATGAGACGGATTGTCCTTGAT
ATTAAAAAATTAATTCCGTTATTGTTCTACTTGTCACTTGTTGATGATGTTAATCGTTAT
TAGCAAATACGTTGAATGAAAGAAGAGAGTGGAGGAGAAATGGGGCTAAGTAGGTGCTCT
GTTCATCAGCACGTGACATCAGTACTCACAGAAGAGACGAGACTGATTTCAGTGGGCTAA
AATCAGGTGCATAGCTCCCAAGTACACCCTCCAGACACACATGCCAATAGATGCTATTCG
TTTCAGTTCTTCAGGAAAAAAGACTTCAACAGGAGATCTAAAACAAAAACAAATTGGGAA
GTAATTTGTATTTGGCTGTTTCTTTTGAAAGTTCAAGGTGTGGTAGCCCTTATCAAAGCT
GCAGCCGCTTCCACATAGCAGCTCTGGTCAAAAGGGAGCCGAGAGTGACAATTGTCCTTG
ATGGCTGCCTTTCTCTATAACTGATCTGCAACATGTCAGGAAAAGACAGTCCTCAGGTAC
AGCTGGAGACTGCAGTTAAAATCAGTGTGATTCCACAGGCTGCCAGAAATGCCGGGGTCG
TGCGTTGAGGGATCAGAATAGGCTTTGGAGAATAGCTGCCCAGTCAAGGAGCAGCTGTGT
GGGGGGAGGTGGTAGAGGAGTGGACATTTGTCCTGGGACCATCTGTACTGTGGCATAGAC
CAAGGCAATTTTTTAGGTCACAGCCTTGGAATGCTGAGGCATTAGGGTCAGGACCAAAAG
CTGGGCAGACCAGATAAAGGGAACAGCTGTGGACAGTTGTGTTCTAATCTTAGAAAAGTA
AAAAAGAAATAATAAATAAGAAAGTCCAAGTGGTAAATAGTAAGCTGAAACTTACAGCAT
AAACTGCGCTATAGGAAATATGAAACCTCTTTAGTCAATTTCTTAAACACTTTTAAGCCA
GTAGAAGATAATTGGGCTTTCCTGAAACAAGAATTACCTACATACTTCTTCTTATATCAG
TTTTACCCAATACTAGCCACTGTTGATTGTTTAAATTAAAATTGGACAAAATTAGAAATT
AATTCCTCAGTCACAATAGTCATGATTTCAAATGCTCAGCAGTCATCAACTGGCTAGTGG
CAGTCAAATGGAACAGCATAGATAAAGAACATTTCTGTCACAGGAATACTGTTACATAGG
CTGTTCTAGATTATGATATGGAATATACATTAACATCGTTGACCTCTGTCTTTTTCTATG
CTGTATGTTCAGTGAATATTACAGTGAGTTACATTGTGGACAACAAATATTTATTAAAAA
CTGAATAAATTAAGTGATTAGAAAGCAAGAAATATCCAGTTTCAGTTGTAGACTTTAGGA
AAATTCAAGGCTAAAAATTAAGCTCAGATATGAGAGAGGTTTTATATAGAAAACATTGCA
TAATTATATAAAAATCACAAAGAAGAAAATTTGACTTCATTTTTTTGAAAATTTTTTATG
TTTACTTCCAATTTGATTAATAACTATAATA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved