Oryctolagus_cuniculus Locus Mono:50:SNORA3
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:50:SNORA3
Oryctolagus_cuniculus
Mono:50:SNORA3
scaffold_83265
SNORA3
1001..1130
2130
GCATGGTGCGCCGGCCGCAGCGCACCGGCTGCGGCGGCCATTGGAGGGTGAACCAATGG
CAAAGGAAGACCTTTATCTCTGTCTCTCTCTCTCACTGTCCACTCTGCCTGTCAAAAAAA
AAAAAAAAAAAAAAAAAAAATTATAGACTGAACCAGCAGATGGAAGATTTCTCTCTTCAA
ATAATTTTTTAAGAGACATCTGATAAATGATTTTAATTCTGTTGCTGAATCAATAGTTTT
TGATGCTGTATATTAACTTTGTTAACTACAAGAGGTACAGCAAAGACTAAATGAGATAAT
ATCTGTAAAGTGCTTAAAACAGTGCTTGGTTTATGGTAACCATTTATTATGTGAGCATGT
AAAAATAAATTTAAGGGCAGAAGCACAATTTATTGCACATTTTAACTCCTAAAGGACTTA
TAAGTTGTTTTGTACATGACAGGGCCTCAAGTTACCAGTTGACTGCATTAACAGCCAATT
GTATCTTGCACTTCCTGTATTAGTTTTTTATGTAAATGCAGCTCTACATTTACACTCATT
TACCTAGAAAAGAAGTCATTTTTGTGCAGCTATGCTTCTGTAACAACAGGTAAGGGCCTC
CAGTGCATATCCATAAAAAGGAGTGTAACTTGAATGCTAAAGGTATCTGTACTACTGCAT
AGGCCTCTCTGCTGGTATTGTTTTCGGCACTGGTTGAAATCTTAAGCATATGCATATTCT
TTTAACTTACCACATAGCCTCGCCTCATCAAGATATTTTTATTTATCCTAATGGTATATC
ATAAATTGTGACCTACAGATGTCTCTCTTCAAGTCACAATTTTTATTGTAGCTTCTTTGT
TATAAAACATTTCAAATACAGTTCATCTTCATTATCCATGAGGAATTGTTTCCAGGACCT
CTGGTGGATGTTCAAGTTCCTTATATAAAAAGGCATAATATTTGCATATATCCTATACAC
ATTCTTTCATATCCTTTATTTTTCTAAAAATACTTATCTGAATTGAGGCGAGAGTCATGC
TTGGGTATTAGCTATTGCCTTAGTGTGCTAGAGTCCTTGAAGAGTAAGTGTTGATTTTAT
TCACTGGCTGTAGGCCTCAAGGCACAGTCAGTCACCAGGTTAGTGACAGACTTCAGAGAA
AAAAAGATTTTTTTATCTGAGAGACAGAGAAAAACTCCCAATTGCTGGCTCATTCCTCAA
ATGCCTACAGTGGCCTAGATTGGGCTGGGGCTGAGCCAGGAGCCAGAAGCTCAATCCAGG
TCTCCCATATGGTCTCAAGTAACCCAGTCACTTGAACCATCACTATATCCGAGAACCTAT
ACTAGCAGGTGCCAGAATTGGGTAACAAACCCAGGTACTCCTATATGGGATGTGGGCATT
TTAACCACTAGGCCAAACTCACACCTCTCCCACTTTCTCCTATATTTTAAATAATCTCTA
CATTATTTATATACCTAACACAATGTAAATACTATGTAGTAGCTGTTATACTATATTGCA
AAAAAAAAACCACCTAGTTTTAGAAAGCCTAATTTATAAAAATTTGTAATTTTTTAGAAT
TGATAAAAAGTACGTACATGTTCAGTATAGATGCATTTTTCCCCCAAATATTTTCTGAGG
TTGGTTGAATCCATGAACGCAGAACCCACAGAAGCTGAAGGTCAGATTGTATGTAGAAAA
GTGCAGGAGCTGGCACTGTGGTGCAGCCGCTACTTTTGATGCTGGCATTCCATATAGGAG
TACTGATTTGCGCCCTGGCTGCTTTGCTTTTGATCCAGCTTCCTGCTAATGTACCCAGAA
AGGCAGAAGATGATCCAAGTATCTTGGGCCCCTGCCACCCATGTGGAAGACCAGGATGGA
GTCCCTGGCTTCTGACTTTTGCTTGGCCCAGACCTGGCTGTTGTGGCCATTGCGGAGTAA
AGCAGCAAACGGAAGATCTCTCTCTCTCTCTCTGTCCCTCTGACTTTCAAGGAAATAAAT
CTTTAAAAAAATTTTTTTAAAAAAGCACAGGTAATTTTCACTGTGGCTTAGAAATACTCA
GTTTTCAGGAAGAAAAACATTTATCTGTGATAGCAAAGTTCTAAACAACTGAAACAGCAA
AATACCCTTCAAATCTTTTGACAATTAAAAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved