Oryctolagus_cuniculus Locus Poly:3:SNORD113
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Poly:3:SNORD113
Oryctolagus_cuniculus
Poly:3:SNORD113
scaffold_209684
SNORD113, SNORD113, SNORD113
1001..1072, 1823..1891, 3157..3231
4231
TAATTGGATCAGTGAAATCATCAAACAAATATGTAAATAAATAAAGAAGTGTAGCATTG
TCCAGCCATGACTCTACTCTGAGAAGCAAGGAGCTAAGTAGGATTCATTTGAGAGGCAGA
GTTACAGACAGAGAGACTGAGAGACAGAGAGGAGTCTTCCATCGGCTGGTTCACTTGCCA
GATGGCTGCAGTGGTTGCCGGTGGGCTGATCTGAATCAGGAGCCGGGAGCTTCTTCTGGA
TCTCCTACGTGGGTGCGAGGGCCCTCCTCCCCTGCTTTCCCAGGCCACAGCGGAGAGCGT
GATTGGAGGAGGAGCCGCCAGGGCAGGAACCGGTGCCCGTGTGGGATACCTGTGCTGCAG
GAGGAGGCTTAGCCTACACGCCACAGCGCTGGCCCCTATTAATATATATTAAAATCGCCA
AGAGCCATTAAGAAGCAAAAACTCAAATGTAGAGAGTAAAAAAAATCATGTCCCAACACT
TGTTTGGGTATACCCATGTTTGTAAATAAAAAAGTTACCAGAATTGAAGACATCCTAAAT
GCTGATAAGATCAAAGAGGGCTACAGGGAGAAATGGAGAGAAGGTCAACGTTTCCACCCT
CTGTTCTGCCTTGTGCTCTAGAGCGGGCGCCCCCGAGTGGATGCATGTCCTCCTCCATGG
TCACAGCTCTGCAGGCACCCTTGTGTGTGTGCAGCATAGGGTGTAACGTGAGTATGGTCA
AGTTCTTGCCTTGGTTGGGTGGTTTTTAAACCATAGCCTCTGTGTCGTTAAGAGCATCAT
CTGTAGACCATGGCCCCACACCACTGTGTTGATTAATCAATATTGCACAATTAAAACTGA
GTGCAACAAGACATCGGACAAATGTTGGAAAAGATCCTGTGGGTCGCAGGTGAAGCACAC
CCTAGGAGCCTGCTGTTGATTTTCCTGATGCATAGCTACGTGATTAGTGTTTCCACGCGG
GTGAATTAGGAGCAGATTTCAGGGGAGAAGGAGGCCGGTCTTGGATCGATGATGATGACT
GGTGGCGGATGAGTCGAGGATCATGACTACTGGTCTGGAAGGCTGAGGTCCAAGGCCGCG
AGCAGGCTCCTCTGCGCCTCCTCATCCCCGCGACGGGACCTGCCAAGGCGTCCATGCATT
GCATTCAGTTTGCTGTAATTGATCAGTGAGAGAATCATTAAAGAAATACTTGAATGAAGA
AATGTCCTTCATTGTATCGCACACACTGGCGTCTGTTAAGGAGTAGAGGCTCAAAGGTGC
TACTTCTTCCGAGGTTGGCGCTTACAATAGAAGCAGTGACTGAGTCCCTGTTTGGGTAGG
GCCATGCTCATTATTGCTTGTTTTCTCAAGAAAAGATGTCATCAGAGTTTAACACATCCT
TAAATGGCTAATGAAAAATAAAATGGCTAATCAAAGGTCCCTGTTTCTACATTCTGTTCT
GCTTTGTGCCCTCAGAGCCGCGCTGCCGGGCGGGCCACGTCCCCCTCCATGGCCACAACT
GTGCGGTGCCGCCCGTGTCCCGGGTGAGTACAGTCAAGTTCTTGCCTTGGTTTGGGTGGG
TTTCAGCCATATTCCCTGCATTTTATATAAACTGTGAAGGCTAACCATGGCCCAGTGATG
AAGACTGTGGTGTGGTCCATTAGGAATGAATAATCAAAGAGACGTAGCCAATGTTGTGAG
TGATCTGGTTGATGGCTATAACGTATTGGTAAGCATTTTATTCTGAAGTTTGTGACACTC
ATAGTTACTTAATCATCAGCATTTAAATGATTCATTAATAAATAAGCAAATCCAGAAGTC
AGCAGAGGGGAGGAGGCCGATCTGGGATCAGTGATGATGACTGGTGGCGGACGTCGCGGT
GACGACTGCTGGTCTGGAAGGCTGAGGTCCAGCACATCTGTCTCCTCTGCCGCCTCTGCT
GCAGGCTTGGGGATAAACAAGAGAAAAAGCGGTATCTGTCATCGAATTCATGGCACTCAG
ACGACAGACTAAATTGCGCGGAGGAGCGAAGGCGCGAGGGCGAGAACATCTCAAAGCTCC
CTTCACCGCTCTGCTCTTCATCCTCAGGACGATGCACTTGAGTTGCACTTGAGTTGGTGA
ACCCGCTCTCCTGGGCCCCGCCCTCTGCGGGCGCCCCGTCACCAGGGGCACAGAGACGGC
CGTGAGTAGCAGTTGCACTTCTTCTTTAGCTTGAATATTTCTAAAGACGCATTTAGTACG
ACCAAAGAAAGCCACTGGTGACCCCGTGATAAATACGCAATTATGTGAAATAACCCACAT
CAGCAGTAATGGCTGCTCATCATCTTCGACGATTCGGAGATGACTAATAATATGTGTCTG
AAAATCAGAGGTTCCGTAAAAGTGGATCTAATCTACTGCCTTGATTAGAAATGATCTAGA
GACAAGGAGAAGGGTGGACAGTGTCCTTGCTCTTTGTGTTCATGGATGTTGATGCTATTA
TTCTTGTGTGTATGACAAGTCTACAAGGAACCAGTAAATAAATGTAAGGAAATCAATGTG
AATAGGTGAGCCATCAACCAGTTATCAAAATATGTCATTCAGCACGTGAATCCGTTCATA
TATATTAAAAACTCTGAAACGAAGGGCCGTTCAAGAAGCCTGCTGTTTTGGCTAAGGGTT
CTAAAGATAGCAGTGATAGTTGCATTATTAGTTTAGATCAGTGAAGATCCATAAGCAAAT
ATAGACGCGTGTAAGCAGGGCGTCCCAGCTATGAGAAGAAACACTGCCACGAGCGCGCAG
ACACAGCGTGGAAACCAGGCGCACAGACAAGACCCCCGTTTTAAACGTCGCCCCTTGCTC
CGCGTTCCCAGGACGAAGCACTTGAGGTGGTTCTGGTTTGATGGTTGCCTTTATGAATCT
GGTGCTTGAAGCCAACGTAATAGCCTCGTTGTCTGAATACGCTTTTTACCCAGGGCACTC
ACTGTGTGTTTAAAAAGCGTGAAATCCTATCACTGTAACCATCTACGGCACAATGCATCG
CGAGCATACTCCATAGAAAATTAGTCTAGAAAGATGTGGGATAATCAAGGCTCTTGGCCT
TAACTGTTTTGTCATCCATAGTTACTCAGTTTTAGGGAATAAATGAATTAGTTTACGAAC
AAATGTAGGTGACCACGAGGAAAGAAAGGTAGATATTTGGACCAGTGATGCTGACTGGTG
ACGGATGAGGCCTGTGTGATGGACAGTACCTGTCTGGAGCTTTGAGTTCCAACGTCATGA
GAAATGCAGTCTAGGGGGCGATGCTGTGAGTGAAGCCACTGCCTGCAGTGCCGGCATCCC
ATCTGGGCAACGGTTCAAGTCCCAGCTGCTCCACTTCCCATCCAGCTCTCTGCTATGGCC
TGGGAAAGCAGTGGAAGATGGGCCAAGTCCTTGGGCCCCTGCACCTGTGTGGGAGACCAG
GAGGAAGCTCCTGGCTCCTGGCTTCGGATCAGCCAAGTCCTGGCTGTCTCTTCTCTCTGC
CTTGCCCTCTCTGTAACTTTCCCTTTCATGTAACTAACATGACTGATGGGCCAAGCGCCA
GGCAACATCAGGGATCAATGGAGACGAGTCTCCGCCCAGCCTTTTACTTCTCAGAGTGCG
AGCACCGAGGCTGCGTTACGCGTTTTCCCACGTCCACATTCTCACCGGTGCCTTTGGCTG
GGAACTTGGAGAGCAGTGTGATTGAGGTGTGATTGAGGTGTGATTGTGGTGTGATTGCGG
TGTGATTGGTGTGATTGCGGTGTGATTGTGCTGTGATCGCGGTGTGATCGTGGTGTGATT
GCGGTGTATTTGCAGTGTGATTGCGGTGTGATTGTGGTGTTTGCGGTGTGATTGCAGTGT
GATTGCGGTGTGATTGCGGTGTGATTGCAGTGTGTGCGCCACATTATGGGGATTTTTTAA
GGCATTCACTGTAAAATCTGCAAAATACTCAACATTAACAGAGCCATCCATACCGGATGA
TCCATGTAGAATGGATGTGAAACATTATGTTCATTAATTAATATTTCTAACATTGAGATT
GATTAATAAAGCAGATGAAAGATGAGGCAAGTGGTTCTGTGGATTTTAGGGATACTTGAG
GGTCTTGGGTGTGGGGATCTTGATTTGTGCTCCTCAGAGGGGCTGCATTGGAGTGAGTTA
AATCTTGGGGTCACAAGAAACATTGCTTCCTCCCTGTGTGTGGTGCGAGCAACCGGTGTT
GAGTCTCCAGGAGTAGACGTGAAGTGTAGTCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved