Oryctolagus_cuniculus Locus Poly:8:SNORD115
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Poly:8:SNORD115
Oryctolagus_cuniculus
Poly:8:SNORD115
scaffold_94799
SNORD115, SNORD115
1001..1081, 4621..4701
5701
CTCCAGTGGATCATGGATCCATTGGAACCTAGGCTGTAGTAGTGCTCAGGCTGATATCT
GTTAGGGGGATCCCAACACACTGGCCATGGCACCTAGAAAATTGTGCCAGGCAAGCAACA
TGCCACTAAGTGCCTCAACCAGGGACGGCTGCTCAAGGGCCACATGAGTGCACCTCAGCC
TTAGTTGAGTGCCTCAAGGATGCCAGAGACCCTCCTGGGCATGGGCTTCTTCTCCATGGG
AGGCTCCAAGTCCCCAGGGGAGGACTGCACCATGGTACAGCCCCATGACTGCACCATCTT
TGGGATTTGTATGTGAATCCAGGGGACAGTGACCACAGCAAGAATGTATCTCCAAGTGGT
AGAGAATGAGCTTCCAGGACGCAGTCTGTGCATGCAGCCTGGCCCTCAGCACCCTGGCCT
GGACTGGGATGCCATGTTTCTAGGGCTAGGACCAAAAGAGGGCCTCCTTTGTGTGTCTCA
TGTGATCAGTTTTCAAATGCCAAGGCTGTGCCAGTGCTTGCTTGTCCAGCCCAGGTACTG
GCCTGGACCTGAGTCACTGGGGCAGGAGAATCAGTGGAGAATGCCACATCTCTCAGTGAG
ACCCATCCTATGTGGCCCTCTTGGACCAGTGACCTACAGGCCCAGCTGTTGGGAAGCTAG
GTGAGGGTAGCTTGCCAAGACACCATGACTAGAGGGAGGGCTTCTGGCAATTTTCTGGAC
CAGTAGGGGCAAAGCATGCCTTAGAACCAGTGTGCTCTACTGTTCCTACTGTCTGTTCAG
TGATCGTCTTCTCTGTCCACAGATGATATCATCAAAGGAAGCTCTTGTATATTCCACTGC
CATGGTGGCAACAGCTGCGATCGAGGCCCAAGCATCCCATGAGCTGGAGGTGCCATCCCT
GTTGGAGTAGGAAACATCCGTGACTTTCAATGGTAAACTAATCCATCAGGGCCCTGAGCT
TGGGTGGAGTCAGGACGTCCTGTGTTATGGTTCCTGAGGTTGGGTCGATGATGAGACCTC
ATACTGTCTTGAAGAGAGATGATGACTTAAAAATCATGCTCAATAGGATTACACTGAGGC
CCAGCCTAGTGACAGTGGTGCAAGTTGGCATTGGGATAACCAGGTACCTTCCAGGGGAGG
AGACTCTGGAGACTGGTTACCTTGAGGCCTGTCAGGCCAGGACACAGTCCACAGGCAGAA
ACTGCTCGTGTTGGATGCACCCAAGTTTCATCTTCCTTGGGCTTGGTGTGTGCTCCCCAC
TGTCAGTTGCAGGGCTGTGCTGGGAGCTCCTTCCTCAGCTCCTTTCTTCCCCTTCTGTCT
TTCAGTGAGTAGAGCAGCATGGCAGGGCATCCTGTCAACCCACTTCACAGGTGAGTGGAT
GGTGGTAGTTAAGGGGCCTTTGAAGGATTACAGGAGTGCTGGGTGGGTCACCTGTCACAC
CTGAGGTATCGACCCACGGAAACACAGGAGGGCAGCCTCAAGCACTGCTACTTATTTAGC
TCTGCACTTTGTGCTCTGATGTCCAGAATATCTTTACTGTACCTCTATTGGTGCATGCCA
GATAAGAAATGCAAACGTTTTCTGAGGGAACATTCACGTTGCCTTAGTGCTGCAACTTGG
CCAGGGTTGGCTACACTGGCTCTGAGTTGCCTTGCTGGTTTGGTAAGAATTGGGTGGTCA
CTGGGGATCTGACCTCCAAGTGCAGGCACTTCTTAGGTTTGTTTGCAGGTCTCAATGTGA
ACAAACAGAAGGAGAGAGAGGGATATTGGAGGGGTAGCTGGCTTTGCAGGTACCTGGAAG
CCTGGACCTTTAAGTGGTTTGCCTGGCTACCGGTGTTTAGAACACAGGGACACTCGATCA
GCTACCTGGTCAAGTGTTGCTGACACATGGGCCCTGGCACCTGTGGGGTGCTGCCAGGCA
TTCAAGATCCTGATCAATTTCCACATCCAAGGGCCTTCAATCATGTGTCACATGGGTGGG
CATCAGACTGAGTTGAGCCCAGTAAAGTTCCCTCTGGGCCCTCATTCCCACTATTCCATG
ATAAGTAGCAAGGCTCATCTTAGGGGTAGATGATGGTCCAGCCCAATATCCATACTCCAC
TTTTGAGACATATACAGGACTGAGGTGAACTGGAACCACAGAGGAAGGTATCTCCACTGA
ACACAGCTAAAATTGGGGGAATCCAGTGTGTGCATGCAAACTAGACCTGAATGCCTGGGC
GTGTGCAGTGATGATTTGTTATTAAGCCTGGGACCCCACCATGGCCTCCTTTGGTGTATC
TCATATGACCAGTCCTCTGAGCGCAATTCTTTGCCAATACCTGCTCCTTATAGCCCAGAT
CCTGGCTGAAACCAGGGAATTGGGTATAGGTAGGAGCAGTGGTTGAAGTCACTTCCTGTA
GTGTAACCTAGCCCAAGTAGCCATATCTAGCTCAGTGACCAAGATGTCCAGCAGTTCTTG
GGAAAGGTGGATGGAGCTTGCCAACAAGCCACACCCACATGACAGGCCTCCTGGAAAGCC
TCACTTGGGCTCTACATGTCCAAAGCATGTCCCAGTGCTTGTGTACTTAGTCTGTCCCTG
CTGTCTGTTCACACCCACCCTATCCTCTTCCACAGATGAAGTCACGAAAAGAAGCCCCTG
TGTGGTCCAGTGCCTCAGGGACAAGTGCTGTATCTAAGCCTCAGTGAACGTGAGCTGCTG
GTGCCAGCCCCTTGGACCGCCCCAGGTAAGCTCATCCCATCTGAGTTCTTGAAGTAAGAT
GCTCCAAAGGCTTCTCCATGCTGGGGTTCCTGGGGCTGGGTTCGATGAATAAACCTCTNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAATAGGATTACGCTGAGGCCC
AGCCTAGTGACAGTGGTGCAAGAGGATCTTGGGGTAACCATGTGCCTTTCAGGGGAGGAG
AACCTGGGGACCTGCAGGCTGCCCAGACAGAATGTGAGCCCCAGGCAGAGCTGCTTGTTT
GGATGATATGAAAAAGCTCTTTCCTCCTTGAGCTTGGTGTGTGCTTTCTACTTTCCAAGT
TGCAGAGCTGCACTGGGGGTTCCTTCCTCAGCACCTTGGTCTCCGTCTGTCTTTCAGGGA
GATGAGCAGCCTGGCCTGGCACCTTTCAACAAGAGTTCTAGGTGAGTGGATGAGGGTGTC
ATTTGTGATGTATGAGACCACAGGGGTCTGGTGGGTAACCCCACTGCAGACTGAGGAGTG
GACCTATAGCCATTCTCCTGATTGAGCTTTGCATCTGTAGGCTTCAGAGGTGCAAATCAA
CTAACCTAAGCCTGTGGCCTGCTGTTGGGCCAAGAGAGTGTGGAAATGGTTCCTGAGGAA
GGGCTCATGTGGAGCCAATGCCTCCACTCAGCCTTGGTGGGCAACCGCTGCTCTGCGTTG
CCTTGCTGGCATGTATAGACACTGAGGATCAAGCAACAGAGTGGGGGCAGTGCTGAGATT
TGCAAGGATACCTGGGTCATGAACCACACTGAGGAAATGAGGAAGGTTTGGTAAGGTGGC
TGGCTCTGCAGCTGCCTAGAAGCCTGGCAGCTTTATGTGTGTCAGAGAGCTATTAGAGCC
TCGTAAGCAGGAATGCTCAAGCTGGTAGTCAGGGGTGTGCCAACACGTGGTCCATGGCAC
CTACAGGGTTGTGCCATGCATGCACCATCCTTGCCACTTGCTTTTTCAAGGGATTGGAAA
CAGAGGCCACATTTGTAGGCTTCCACTGAGTAGAGCCCATTAAGGACACCAGAGCACATC
TCCTGGTCCCAGGCTGGGCTCCTTCTTTGGAGGTACCAAGGTCCCTTTAAAGAGTGTGCC
ATGGCCCAGGCTGATGCCCTTTCCCCACCTTAGGGATGTATATGGACTATTGTGGGTAGC
TGCCATAAGACGAAGGTATCTCCCTGATGCACAAGCATAGCTCCTTGGATGTAATGCTTG
TACATAGCCTGCACATGAGCTCCAAGACCTGGAAAGGGATGCCATGTTGGTAGGCCCTGG
GTCCCACCAGGGAAGACTTGGTTGCATTTCATGCCACCAGTCTGCCACTTGAAGGCCATG
CCAGCAGTTGCATGTAAGGCCAGGTAACAGCCAGAAAAAATGGTAGGGGAAGCCACTTCC
AGCAGGGTGACCCATCCCAAGTAGAGTACTCTGGCAGTGTGACCAATATGCCAAACAGTT
TGTGAGAAAACAGGTGGTAGCCTGCCTGAGCTCCATATCTACACGGGTAGCCTCCTGAGA
AGCCTCACTTGGGCTGAATGGGTAACATGGTGCTCTGGAGCAATGTAGCCAGATCATGCC
CCTGCTGTCTTTTCACACCCAGTCCCCTCACCATGCTGCAGGTGATTTGAGTTGAGGAAG
CCCCTGTGGCCCCAGTGCCCTTGGTTTAAAGGCTGTGGTCAAGGCCCCAGTGGCCCATGA
GCTGGAGTTAGCAAACTCACTGGTGAAGGAAATGTCAATGTGTACCTGAGGTAAGCCAAT
CCATCCAGATCCTAGAGATGGGATGGCACCAGGGGCTTCCCATTGTGTGGTTCTTAGGGT
TGGGTCGATGATGAGACCTCATACTGTCTCAAAGAGAGATGATGACTTGAAAATCATGCT
CAATAGGATTACGCTGAGGCCCAGCTTGGAGGCAGTGGTACAAGGGGAGCTTGCAGAATC
AGATTCCTCCAGGAGAGATTTTGCGTATTGGAGATCAAGGCCTCCCAAGTAATGATGCTG
TCCCCAATAGGAAAGGCTGTTGGTGCAGGATTTGCACAAGCTCTGTCCTCACTGGGCTTG
GCTTGTACTCCGTGCTGTACATGTTGCAGGGCTGCACTATGGAATCCTTCCTCAGCTCCT
TTCTGCCTCTTGTGATTTTCAGCAAGACAAGCTGCAAGCCACGGCACTATCTTGACTGTT
TTGCTAGATGAGTGGATGGAGGGTGTCACTGTGCATGTGTGGGGGAGCAGGGAGTCCTGG
CAGGTCACCTGTAGTGAGCCTCAGGGATGGAACCACGAAAACACAGGAAGGCAGCCCAAG
GCCATGCATGTGTCTGAACTGTGCTCCTTAGGTCTTTCATGTATTGATTGTTTGAAAAAC
CCTGGGCCTATTTTGGAGTCAATAGAATAATAGAAATTTTTCTATGAAGAGAGGTCACCT
GAGGCCACTGTTATCACTTGGCCTTTGGGACTTCAGCTGCCCTAGCTCATGTAGGCAGAA
GTGGGTGGACACTGGGAATCAGGCCACAGAGTGGGACCAGGGCTGAGATTCACTAGGAGT
CCCAAGTCATGGGCACACTTGGCAACAAGGACCGTTTGGCAGGCTATCTGGCTCCACATG
TTCCAAGCAGTCTTGGAGTTTTATGTGGGTGATGGGACCACTGGAGCCCTGGATGCAGGG
AAGCTCAGGCCAGTGCCCTATAATTGGGCTGATACAAATGAGGTATGTAACCTGTTAGTG
CTGCCAGGCATGCCCCATCCTCACAACTTGCCTCATCCAGGGGCTGGCATTCGCAGGCCA
CATGGGTGGGCTTTGGACTCACCTGAGCTTAGTGAGGATGGTAGGAAGCTTTCAGTACCT
GGGCTCTAGCTGCTCCATGGTAAACACTAAAGCTCCATGAAAGAATGGGCCATGATTCAG
CC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved