Oryctolagus_cuniculus Locus Mono:136:SNORA51
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:136:SNORA51
Oryctolagus_cuniculus
Mono:136:SNORA51
scaffold_180397
SNORA51
1001..1128
2128
TTCACTGGTTTCAAATTTGTACAGTCCTATAACATCAAGCATGGGAATAGAAGAGACAT
TAATAAGATACGCCAAAATATTGTAACTGTAAATTTTTTATAATTCAAACTCCAGGGGAT
ATGAAGAACTTACTAAGCAAATGTAGGTTTCTGTGTGAAAGAAAGAAAAAACAGAGGATG
CAGGAAGGGTTTTAAAAATATTATAATATGGCTTTTTTAAAAGATTTTTATTTATTTATT
TGAGAGGTAGAGTTACAGACAGTAAGAAGGAGAGACAGAGAGAAAGGTCTTCCATCTGCC
GGTTCACTCCCCAGATGGCTGCAACTGTCAGTGCTGGGCCAATCTGAAGCCAGGAGCCAG
GAGCTTCTTCCAGATCTCCCACACGGGTGCAGGGCCCAAGCACTTGGGCCATTTTCCACT
GCTATCCCAGGTTATAGCAGAGAGCTGGATTGGAAGAGGAGCAGCCCGGAATCGAACCAG
CACCCACATGGGATACTGGCACTGTAGGCAGTCATAGTGTTGGCCCCACAATATGGCTTT
AAATTTTGTCATTTCACTCTAAATTTGAACTGGAGTTAGGAAGGTTTTAAAACAGACTTG
AAAGATTTTTTTCTTTTTACAAAATATTTATTTATGTTTTTACTTACTTGAAAGGCAGAG
AAAAAAAGAGACAGAGAGAGGGGGAGAAAGAGTGAGCTTCCATTTGTTGGTTCACTGAGC
CCAGAACTCCATCCAGTTCTCACACATGGGTGGCAGGGATCCTATACCAGAGCCAGCACA
TGCAGCCTGCTGAGTTGTGCATTAGCTGGAAGCTGGAGCCAGAGCAGAGCTGGAACATGA
ACCCAGGCACTCTGATACACGACACAGGTGTCTCAAGCAGTGTCCTGAGCACTGCACCAA
ACACCCCCTCGACACAGGAGATCTGACACAACATCCTTATTCAGAGCCACCGCCCTTGAG
CCTCAGTTATTAGACCAACAGTGCTTCCAAAGGTGGGTGGAGGCCTCCTGGTGCTTACTG
CAGGCCATGTTCTTACACTGACTGTACAGAAAGAGGACTCATAGTAGACCTCCCCCCTAT
ACACCCAGCTCAGGCCTTGCGGTCTGTATTGTGCCATAAGGGGACATGGAAATTTAAAAA
AATAATTACAATTTAAAACAAATTAAAATAGGGTTGGTGGAAAATGGAACTAAAAGGCAC
ACTTATTTTGGAGCAAAAAAATCAAAATCCATGCATATAAAGGGTCTTCAAAAAGTTCAC
GGGAAATGCATATCATGAATAAACTATGCACAGATTCAAACTTTTTTGTACCACAATAAA
CTGATCTTTTCTTCTACTTTTCCATAAAATCTCTGAAGTATTGTCATATATATTCATTTC
CTCTGAAAAACACAGTCTCAGTGTGAGTGACAGACAACACTGGTCTGGTAAGTGATTTTC
CATCAATACACTGCTATTTTTAGATATTTAAATAAACTTATTTTTAAAACAGATTTATTA
ATTTATTTGAAAAGTAGAGCAATAGAGAGAGGGACACACACACACACACACACACAGAGA
GAGAGAGAGAGAGAAGGAGAGAGTGAGAGTGAGAATGAGAGAGAGAGAGAGAGACTCTTC
TACCAATTGGTTCACTTTCCAAATGGCCACAACAGCCAGGGTTGGGCCAAGCTGAAATTA
GGAACCATGAACTTCATTTCAATCTCCCACATGGGTAGTAAGGGCCCAGCACTTGGGCCA
TTATCTTCTGCCTTCCCAGGCACATGAGCATGGATCTGGAATGGAAGTGGAGCAGCCAGG
ACCGAACCAGCGCACCAATGTGAGGTGTGGGCATTACAAGCGGCAGCTTAACACACAACG
CCAGGTCCTGTGACGGGGTCTTAACTCGGAGGGCTGCCCCCTCAGGGTCCGTACATGTGT
CCCCAAGAGAGCTCTAGGTGCTCCTGGCAAGCACCCGGGCCACCTGCCGGGGTCCATCTC
TCGGCCCCCACAGCTACAGCTGTCCCCACTGGGCTGTGGCCTGGTGCCAGGCCTCCCCGT
CCCAGGTCTCTTGGTGCCAACCATTGGCAGCCCCGATCAAGTTGCAGGCTGGCAGTTGCC
TTGTCCCCTGCAGGTCCAGTGCTCAGTGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved