Oryctolagus_cuniculus Locus Mono:120:SNORA70
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:120:SNORA70
Oryctolagus_cuniculus
Mono:120:SNORA70
scaffold_144764
SNORA70
1001..1135
2135
TAGGAATGGCAGTTCAAAGCTGAAGTGGATTTTCCTTTTATTTGTTATCTCTAATAAAT
AGTTGACAGAACTCTCTCGCTAAGCTGTGATTTGGCAATGCCTGGTTCTTAATTCCAGCT
ATTTCAAGCACAGTGCAGGAGAACTGCAATTCTGAGGGGCTGGATGTCTGAAACCTTATT
TGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAGT
TTGTCTCCAAGTTTGCATTCTGGGCCCCAATCCTCCCCGAAACAGAATGTCTCTTCCCCC
TGTATTGTGTGCGAGTTAACTTGGCTCTTGTAAAAGTCAGACACCTGTCTGTGTTCTTTC
ATTCATTCAACCGATGCTATTAAATGGTGTTGTACCCCAGGCTCTGTGCCAGGTTCGGGG
AGAACATCTGAACAAAGTAAGCAAGAAAACTTTTTTTTTTCCTTCAACAAACCTTTATTC
AGAAGTAACCGGCAGCACTGAGGTTACAGTAGGCAGGACTTGGGGTAGTAGCGATCACGG
AGAGGAGCTGTGAGGAGCTCTGGGTGCCGGTTACACAGCTCTGCTCATTTTCTGATGTGT
GTGCTACTCTGATAGAAGCTACAGTTGCAAAGTACAGTCCTCGGCAGCCAGCCAAGCCGA
CCAGCTCCCTTCCTTCACAGGGACCTGGTGTGCAGCGGCTGCCAATAGCCTTCTCCTCGG
TACTGCAGGCAGCCTGTGGCGTGGATGAGTTGCCCTAAGGGAGCTTGGAGACAGCCCTTT
ACTGCGGACATTCGTGGCTCTGGCTTCATGCTGCTCCCAACCTAGACTGCAGACAGGTGT
GCGGGGTGCTTTGGGAAACCTCAAGACACAGCAGCCAGGGTTCATGTTGGCCAAGTCATT
GTGTCCACCTGGAGTCAGGAGGCAGAGCCACGTTTTGAGCCCAGGTCCTCTGATTTGGGA
TGTGGACATCTTAACTGCTAGTCTAAATGCCCACTCCCACAAATTTTGCTTTTTAAAACT
CTTCATTAGGGGCAGCATTTAGCCCAGCAGTTAATGCACCTACACCTGTGTTCAACAGTG
GGCTGCAGTTCCTGTGTACTATCAAAGCAGACCCTGGGAAGCAGTGATGATGGCTCAAGC
AATTGGGTTCCAACCACCCACAGAAGAGATCTGGATTGAGTTCCGGGCTTCCGACTTCAG
CCCCAGTTCAGCCCCCAAACAGGGCAGTTTGGAGATGGATAAAACAGAAGGGAGTGCTCT
CTGTAGCTCTGCCTCTCAAATAGATAAAAGAAAAATATTAAGAACCTTTATTAAGTTGGA
ATCTCCAGTACTCATAATACAGTGAAAGGTTCTTTTAGGGTGGAACCAAGTTCTTGTAAC
TTTTTCTAATATTCTTCCTGTTTCTCCCAGGAATCCTGGCACCATTTTGCCCCCGATCGC
CCTTTAGAGAGTGTAACCTCAGAGTATGCATGAAATAAAATACTTTCAAAAATATAAAAA
CAAAGTTAGGGAAAAACATCTCAGTGTGACAGGGATGGGCACTTTCTTCCTTGGCCCCTC
AGTACTCCCGAACATGAAACTTCTGCCTCCCCTTGTATTATTTCCCATCCATCAAAAGAG
ATCCATGGCTTTCACCTTTCCGTAGCATACTGTTTGCATTGTTTTAGTCTTTCTATGTTA
AACTATTCAAAGATGCCCATGGCTTGGGTCATGGGCTGCATGTGAGCAGGACCTCACTGC
CCTGCACTATTTACGGGTGCAAGGACTGGCCCTGAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved