Oryctolagus_cuniculus Locus Mono:232:SNORA7
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:232:SNORA7
Oryctolagus_cuniculus
Mono:232:SNORA7
GeneScaffold_290
SNORA7
1001..1139
2139
TGACAGTGGGAGAGAGACAGAGAAGGAGTCTTCCATCTGCCAGTTCACTCCCCAAATGG
CTGCAATGGCAGGGCTGGGCCAGGCTGAAACAGGAGCTGGGAGCCAGGAAGTACATCCAG
ATCTCCTCAGTGGCAGAGGCCCAAGCACGTGGGCCATCTTCTGCTTTCCCAGTCACATTA
GCAGGGAGCTGGATGGAGGTGGAGCAGCTGGGACTTGAATTGATGTTCAAATGGGATGCT
CANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAATAAATCCTTTTTTT
TTGAAAAAACTATTTACAGCTGCGGTAATTATTTGAAAGGCAGAGATCTCTGTAACTCTG
CCTTTTAAATACAATAAATAAATCTTTAAAAAGGAAAGAGAAAGAGAGGAAGGAAGGAAG
GAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGCAGGCAAGCAAGCAGGCAGGCAGAGAA
ACAGAGAAAGAGCTTCTGCCCACTGATTCTCTCCCTAAATGCCTACAACAGCCAGAGCCA
AGAGCCCAGAACTCCATTTGGTTTCTGATGTGGTTGGCAGTGGCCCAAATATTTGAAGCA
TCCCCACCTGCTGCCTCCCAAGGTGGGCACTAACAGGTGCTGAATGAGAAGCAGAGTAAC
CAGGCAGTTCAATATGAGATTCAAGAACCCCAAGCAATGACTTAACCACTGCACCCCACT
CCTGCCCCTGTGAGTTGATTTAAATAAACCCTTCTTGAGCATCCTTATATTTTTATCCAC
TGTATTGTCTAAGTAAAGACAATGAACTTCATGAGCTAATTTCCCAAAGAACATAGTACA
GTGTAACTTCACACTACATATGCTTAGCTTACAGGAAATCAATTGTTCATGGGCAACCAA
AAGAAAATAAGGAGCAAGCGATAACAAATGAAAGCCCATGAGACCTCCTGGGATCGTGTC
TGGAGAGTGGCCCGTCTTCTGCCAGCTTCAGAAGCGGGAGGGAAAGCAAGGCTGCAGAGG
CACCCATTCCATTCCCAGCTTGTTCAGTAGCTGGTGATTGGAAGACCCTCTGCACCAGGA
CCAGCCCAGCAGGAGAGGCCATCTTTGGGAGTCTAAGCTAACTTGGGTCTGCTGCTTCCT
TTAAAGGCATCATGGCCGCCCTCGGATCCCTGGTGAAGCCCAAGATGGTCAAAAAGAGGA
CCAAGAAGTTCATCTTCCACCAGTCCGACCGATATGTCAAGATTAAGCGTAACCGGCAGA
AACCCAGAGGTATTAACAGCAGGGTGCGGAGAAGATTCAAGGGCCAGATCTTGATGCCCA
ACACTGGTTATGGGAGCAACAAGAAAACCAAGCACATGCTGCCCAGTGGCTTCCGGAAGT
TCCTGGTCCACAACGTCAGGGAGCTGGAGGTGCTGCTGATGTGCAACAAATCGTATTGTG
CAGAGGTTGCTCACAATGTTTCCTCCAAGAACCGCAAAGCCATTGTGAAGAGAACGGCCC
TGCTGGCCATCAGTCACCAACCCCAACGCCAGGCTGCGCAGTGAAGAAAATGAGTAGACA
GCTCGGGTGCACATTTTATTTGTGTTTAAATAAAACCTTGAAAACTGGGAAAGAAGGAAG
GAAGGAAGAAAAGAAAGAAGGGGGGAGGGAGGGGAGAGAGAGGGAGGGAGGGAGGAAGGA
AAGCCTATGGTCCATTTTGGATAATGAGCTTTCAGTTTATGCCCTTGAGGTTGTGAGTGA
GTGGGAAGTGGAAATATGCTACTTACTCAGAACTCTGTTCCTTAGTTTCTCATGGCATTG
TCTTGCAAGGCAAAGTGTGATTCTAGAATTAAAGATCTGTCTTTAGACCTGTATTAAAGA
CCTGGCCGTTTAGGTTAAGCCAAAGATACAAAATTTGATCAGATGCTAACTAGTTGGTCT
TTGGCAAAATGATACAATGTCTCAAAATGCAAGGAAAAGTTTGGGAATACCCAGTTCTTA
TGGGTAGTTCTAACCTTAGAGCCTACATTTCCATCAACACCCACCAGGAATGTGAACCCC
CACAGTGGTGTCTCCTTAAGTTTTAGATACTAGTCTCCTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved