Oryctolagus_cuniculus Locus Mono:210:SNORD116
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:210:SNORD116
Oryctolagus_cuniculus
Mono:210:SNORD116
GeneScaffold_2926
SNORD116
1001..1092
2092
CCAAGGAGGAGATAAAACATATGTTGTTATTAAATTGTCTTAAGATAAGTCACAGTATG
TTGTGGTTGTGATCATTGAAGCCATCTTATACCTTGTATGCATGTCATGATGCAGATGTT
CTGGGTTGGCCTGCATCCAGTAGTAGTGTTTTCTGTTTTGTGTGATTGGCCTTTTGTGTG
ATTGACCCTTTCTTCTGATTCTTTGCAGGAAATTTTTTGGATTTGAGAAAATTACAGTTG
GTAGTGTACTTCTCTGTTACCAATGGGTATTAGGTTGATCAGTCCATTTTTGAAAGCTAC
CTAGACCCTGCTGGTGTCTTCTTGGGTTATTAAGTGCAGGAATCTGAGTTATAAGATGCA
AGTGCTTGCCTTGGTGTCCATTGCCAACCTGATGGAGAGCTCTTCTCAAATTAATGCCAT
TTCCAAGAAATATGGTTAAGAAAAGTAACACTAGTTATTGCATCACTTTGTCTCTTTGGT
GACCATTTTCTTCCTTAACAATTGAGGTGATCATGACAGGGCATTCAGAAATAGTATCTC
CTCACTGACATCATATGATTTGTGAGGAAATGTGTGTGCACCAAGTACTGTTTTAACAAA
AATAGTGACTGTTAGAAAGGAAGTTTCTGGCCTTGTTACAGTATTTCTAGTTGTTACAGT
ATTTCAGTAGATAAAAGAGATAGTTTTCGTTGAAGAATTTGGGTGTAGCAGTAGGAGGGA
AAGTGGTGAGAAGGCGCCTTTTATTTTATGTCAACAGTGAAGTGAGATTGAAAATAGGAA
TTTAGTTTTGAACTGTTCAGAAATTCCAGTCTGAGTGATAAGAATTCACTGACTTAAAAA
AAACATTGAATAATATATTGGTGAGTAAATTTCTCCAGACTTTCTCAGATGTTTCCCTTT
CAGGATTTGAACAGTAGGGACATATACATTCTCCAGAATGGCTGCACATGACTAGGTAAA
CATGCCCATGGTCTGCTTTTCAATAGAAAATGAAGGTTCATGGATTGATATTGACATTTA
AATATGTATTTCTTGGAAGATTGAACAAAATGAATGAAAATGTTATGGCATTGTCCTCAT
TGAACTGAGATCCAGCACTTTGCTTCAGCAGGAAAGAATGTAACAGGGACAATTCTTCAT
TCTTCTACTTAATAACAACTGATGATTGATTCAGGATTTGTGTTTCCTGCTTGGGTGCAG
GACGTTCAGTGAGTCCTTGAAAATATCAGGCCTACTAGGTAGCTTGATTGAGAAGCCTGT
CTTTGAGAAACCTATAAGTGGCATAAGTATAGTCTCTAAGAATAAGGGTGGGTACATGTG
TCCCAGCAATGCTTATGTGAAAGACTGCATCTATTCCACCAAATTCAACTGTAATTACAT
CCGTTAAGTTCTTCAGATCTCCAGAGACACAGCTCCCTCTGGTTTTGAACATAGCACAGG
GCTAGTCTCTAGGAGTCATTATTGGCATCCTTGGCTCAGCAGACTCATCTAGTGGGTGTG
TCTGTTCAGTCATTTTCAATTTTCATTCACATTTGTTTGGTCCTTTGTTCACTCAATCAT
ACAGGTTCCTTCCACTGATGAGTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved