Oryctolagus_cuniculus Locus Mono:43:snoPyro_CD
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:43:snoPyro_CD
Oryctolagus_cuniculus
Mono:43:snoPyro_CD
scaffold_204620
snoPyro_CD
1001..1056
2056
TCAGGTAGTAAACAGTGTACTTTTTTGTACCCCTTTGATGACAGCTCCCTGTTGTCCCC
ACTTCCAAACGTCTCACAACCACCACTCTGCTATGTGTTTCTATGTGTTCTCTTTGAGAT
TCTGCATATGAGTGAGCTCATGTAATTTGTCTTTCTGTGTCTGGCTTACTTCACTTAGTA
GAATGTTCTTCAGGTTCATTTGCCAGTGGCAGAATTTCCTTCTTTGAAAAGGGTGAATAG
TAGTCCTGTGTTTGTGTGTGTGTGTGTGTGTGTGTATCACATTTTCTTAACAATTCATCT
TTTCTCTGGCACTGAGGTTGCATCTATAACTTGTCGATGGTGACTAGGACTTCACTGAAC
ATGGCAGTGCAGAAATATTTGAGGTGCTGACTTCATTTCCTTTGGATAAATACTCAGAAG
CGGGATTGCTGGATCTTGTGTGTTTTATTTTGAATGTTTTGAGGAACGTTCATACTGTTT
TCCATAAATGGCTGTACTGTAGAGTACTTTAAACAACTCTTCTCATTCAATCATTATAAA
AAACATCTCCAAAGTATGCATTACAGTATGCAGTGTCAGAACATAATGGTTATGCTTTAC
CGGTAATATAATATTTACCTTTAGACAATCACTATTCTTAATCACTACAGTTCTTCCTTG
TATATTATACCTACTAAACTGAAATGTTGCCAATATATTATACAGCTATTAAGTTTGGAG
TTATAGAAATTTTGGATTGACTGTTTAAAATCAACTAAACTGATCATTCTCCATCTAAAA
ACCTAATAGAGATTTTAATGTAGTAAAGAGCTGAAGGAAAAAAAAACAGAGGAGGAGTAA
TTCATTGACTGTATTTTGCAGATGCAAAAACTCAGGCAATGTCATCACCAATTTAGTTGC
AAAAGGGAATGGAAAAGCCATTTAGGAAGAGCTGAAACCAGTCCTAAGCTACATTTCTAA
GGCACCTGCAAGATTGAGAAAAAATTGGGTATACAGCATTTGGTTATTATGAGTATAGAT
GATCTGAGCGGTGATGAGGTGGTATATTTCCTTAGCTTAATGATACAGGGGCAAGTACAT
AGGCATTCAGTTTGGTGAGGAGCAATTCCATTGGTCAGTATGGGAGCTGAGAAAGCAAAT
ATTCTGGTCTAAGTTTTATTGCCAAGTGATTCTCAGGAAACCATAGGGATCCAGGTCCTC
TGAGGCTCTTACCTGGTGGCCAGGCTGCTCCAGCTAATGATGTTTGAGTGCCCCTTTGAT
ACAGGACGCTGCATTGCTGAAGTGGAAGAAATGTCCTTTAAGTTGTTTTCCATGACCATT
TTTCCTGTACCTGCAATATGATTGCAACCTTAGTGAGTCGGCATGATAGCTCTTCACAAA
GGATTTGGGACAATTCCCCAGTGACTGAAACATTTCTAGCCCCTTGAAGAGGGGAAGGCT
GGGGACCCTTAGCTATAGACTACTCCTAAGATGATGAATTGCAGCAAGCTCTCCAGTGTC
TTTTTACAGAATTAGAGTAAGTGAGGATTTCAGTTCCAAAGGGTATGCTTAAAATAACTT
CTTGCTGAACCACTGTGGAACCTTTTTGTCCTAGCACCCTTCCCACGTCACCCAGGAAAA
CAGCACCTGAGGAGCCCTCGCTCCTCTAGGAGGGTCTAGAGCCACGTGGCACTTTTGCAA
AGCATCAGTCCATGAGGCTCCTCTCACTTCTTGGAGGCTACTCACTGCAATTCGTTCCTC
TTGGACATGGCCACTTGTGCCTTTACTTTCCTTCCAAGGCTTCCTTTTGCTTTTGAAGAA
ATTAGGATCTTACAAGGGATGGCTGTCAAAAGTTTTGGGAATTTCTAGATCAGAAATAAC
ACAATAGCAAGTAACTTTCTCTTCTGCAAAATGGGCACAATACCATGCCTTTGAAGGGTG
ATTACAAAGGTAAATGCAAGCATGTTTGAGATCAGCAGGTTACATGAACAATGTGAAGCT
GCTTTAAGGTGGAAAAAAAGTGACACATGAATCATTTGCAAGAGTCTTCATGCACCCATA
TGTTGTCCTCTATCATG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved