Oryctolagus_cuniculus Locus Mono:234:snoZ30
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:234:snoZ30
Oryctolagus_cuniculus
Mono:234:snoZ30
GeneScaffold_1550
snoZ30
1001..1097
2097
CTTCTTCCAGGTCTCTCATGTGGGTGCAAGAGCCCAAGCATTTGGGCCATCTTCTGCTT
TCCCAGGCCGTAGCAGAGAGCTGCATCGGAAGTGCAGGTGGTGGCCCCAGTAGCTGCTTC
TTAATCTTTTGTGCTTCAAAAACAAAATACTTAAACTGGTTCATGTTTGCATTTTTATTT
AGTGGGGTTGCTTAAAGCAAAGCATAGAAGATAATAGATTTATTGAAAACCTGTGGGGGC
TGATGTTGTGGTGGAGCAGGTAAAGTCACTGCAGCACCAGCATCCCATATGGGTGCCGGT
TGGAGTCTGGGCTGCTCTACTTCTGTCCAGCTCTCTGCCATGGCCTGGGAAAGTAGTACA
ACATGGCCCAGGTGCTTGGACCCCTGCATTCACATCGGAGACCTGGAAGAAATTCCTGGC
TTCGGATTGGCCCAGCCCTGGCTTTTGCAACCATTTGGGGAGTGAACCAGTGGTGGGAGA
CTCTCTCTCTGCCTCTCTAACTCTTTCGAATAAACAAATTAAAAAAAAAAAAAAAAAAAA
GGAGAGGCCCCCCCTCCTTCCCCCTTTTTCTGTAAGCAAGCCTGAATTTTTCTTTTCTTT
TTTTTTTTTTTTGACAGGCAGAGTGGACAGTGAGAGAGAGAGACAGAGAGAAAGGTCTTC
CTTTGCCGCTGGTTCACCCTCCAATGGCCGCCGCCCCGGCGCACTGCGGCCGGCGCACCG
CGCTGATCCGATGGCAGGAGCCAGGTGCTTCCCCTGGTCTCCCATGGGGTGCAGGGCCCA
AGCACTTGGGCCATCCTCCACTGCACTCCCTGGCCACAGCAGAGGGCTGGCCTGGAAGAG
GGGCAACCGGGACAGAATCCGGTGCCCTGACCGGGACTAGAACCCGGTGTGCCGCCGCCG
CTAGGTGGAGGATTAACCTACTAAGCCGCGGCGCCGGCCCCTGAATTTTTCTTAGATGTG
AAAATAGTGAGTTGGACTGTTGCTTGGTAACAAAGAACCGAACGCAATGATGAGTGAAGT
ATAGTCTGACCTGGTATTGCCACTGTTTCAAAGTTGGCTTTGACCAGGGTATGATCCCTT
AATCTTCTCTCTGAGCTGATTCTGGTTGTGGTATTTCCACACAGATGTATTCTAACCTAT
TTGGATACTGGTTTTATTACATGGTAAAATGTTTCTGTGACACTCCTTTGAATTACTGAT
ACTTTCATGTTTTCTTCCTTCCTTAGGCTGTGGTGAGAAGTCTGGCTCTAAAATCTTCGT
GGAGAACTACATCATTTCAATCCTGAATCTGGTTCAGTTTCCCTATTGACTTACTGTTGT
ATTAAAAATGTATTGCTAAATTAACTCTGGTGTTTGTTTTGGTGTAAACCTTTGAAGTTT
GGGCCTTTGTTCTGTGGCACAGTGGGTTAAGCTGCTGCCTGAGACGCCAGCATCCTATGT
GGGCGCTGGTTCCTGTCCCGGCTGCTCCACTTCCTATCCAACTCCCTGCTAATGGCTGGA
AAAAGAAGATGGCTTGAGTGCTTGGTCCTCTGCCACCCACATGGGAGACGTGGATCTGGC
TTCTGGCTCCTGGCTTCAGGTTGGCCCCACCCTGGCTGTTGGTGCCATTTGGAGAGTGAA
CCCATAGATGGACACTCCCTGTCTCTCTTTCAAATAAATCTTTAACAAAAAAACCCGTAT
AAGAAGTTTAAAATCCATTATGCTCTTACAGTAGTAAAGGCTTTAATATTTAAAATCTGT
AGGATATCCCATTACAAAATTTAGCTTTATATTCTTTGTGCTATCAGAAAATGTCTTCAG
AATTGCTGAAATTAATTACAAAAACTGTCTTGGCAAAGAAATTATTTTCATTGTCCTATT
GGTTTTCTTTTCTTCTTCTTTTTTTTTTTTTTTTTTTTTTGACAGGCAGAGTGGACAGTG
AGAGAGAGAGACAGAAAGGTCTTCCTTTTTACCACTGGTTCACCCTACAGTGGGCGCCAC
GGCTGGCGCACTGCACTGATCCGAAGCTGGGAGCCAGGTGCTTCTCCTGGTCTCCCATGC
GGTGCAGTGCCCCAAGCACTTTGTGCAGTCACATCACTGCATCCCTTGGCCACAGCAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved