Oryctolagus_cuniculus Locus Mono:193:SNORD78
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:193:SNORD78
Oryctolagus_cuniculus
Mono:193:SNORD78
GeneScaffold_5673
SNORD78
1001..1064
2064
CCGGCGCCGCTAGGCGGAAGATTAGCCTAGTGAGCTGCGGCGCCGGCCTGGTGTATTTC
TTTAAAATCTAATAAATATGTTTCACATGCAACCAAACTGGTAAGAATTAAGTATATAAC
TTCCTATACACCACTTGCTAGAAAAATACAAATGATACTGCCACTCTGGAAAACAATTTG
GCAATGGGTAAAAAGTTGGAGATGAGCACACTTCACGATCTAGGGATTCCTCTTCAAGGT
TTATACTTCTTAGAGTAACTCTTGTATGTAGGCAGAAGACATGTAAAGATACCTCAGGAA
GCACTGTTTGTAGCAAACAGGGCATAATCTACATGTCTTTCTTAGGGAAGTGGATACATC
CTGGTAGTCACAGAGTGGCTTACTACCTACAGCTAAAATTGTTTATGGCTATATACATAT
ATAATAAAAGTATAAATTTATGGATGGCTAGGAGAGAGGTTAATTTTGGGAAGGAAGCAA
GAATAGGACCTGGAGAGATTTACATCTCAATTTTTTAGTTAAGAAAAAGTCCAGAGAAGC
AATTATAGTAAAACATAAAGATATGTTTTATGGCTCTTATATTATTTTATGAACTTTTTA
TCAAGTCAAGAGATACATAACATTTAAAAATGCTTTACAATGTAAAAAATTAAAATATTA
ACAATTTAGTCATCAGCTAATGAGATAGCAGCAATGGCACTGCAGCTGATGTGCTAAGCA
CGTTGTTTCTGATCTTTTAGAAAAGTGTTCTTCGAGAGTACAAACAAATATTAGCAATCA
ACTTGATCTGTGGGTTAACTTTTACACTAACAGCTTTTCAATCTCCTTATTCTTGCTGAG
AAATGAACAGGGAAACATGTTGAGAAGTTCTAATACTTATTTCTCTGAAGGCTTTACCTG
GAATAATTTTGTTACTAATTGTATTTCTTAAAATTCAAAGGACTATGGATGGCTACTTGT
ATATTCTTTAAGACTATTTTAAACAATGATTGCACATTCATTTATAATGATGTTGATCAA
ATGTCTGATCTGAAGTGAGCACGTGGACAAATTTGTACTGAAGAACCCTGTAACAGATAA
GGCTGGGAAGAATTTAAGGAGACTTAGCATTTTAATGAAAGTTATGTAAAAAAAAATAAA
CAATGATTGCATATTCGTAATACTTAACTTACAAAGGGTTTTTTGTCAAAGGTAGGCTCT
TCAAATATTTCCTTAATAAGAGTGTCAAGATCATCTTCTTTTTTAAACGTNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved