Oryctolagus_cuniculus Locus Mono:229:SNORA63
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:229:SNORA63
Oryctolagus_cuniculus
Mono:229:SNORA63
GeneScaffold_3812
SNORA63
1001..1122
2122
CACAACAACCAGGGCTGAGCCACGCCAAAGCTAGGAGCCAGGGGCTTCTTCCAGGTCTC
CAACATGCATGCAGGGGCCCAAGTACTTGGGCCGTCTTCCGCTGCTTTCCTAGGTGCATT
AGCAAGGAGCTGGATCAGAAGTGGAGCAGCTGGGACTCAAACCGGCACCCACATGGGATG
TAGGCATCACAGGCCGTGGCTTTACCCACAATGCCAGTACGCTGGCCCCACATACTTCTT
TCTTCCAAGTAGTCTTCCAAGCCCTCTGATGCCCTGCTTAGTGAGAAATCCTTGCTCTCT
CTTCCAGGAACTCTGGAGGCTTTCAGAGTCTGCAGGGTCAGTCCTGTTGCTGCTGTGCGG
TGTGGTTTCTGACACAGCTGTATGCCGTCACTGTTGAGCTGTCCTGCATGGTCCGGGGAC
GTGTGGCCGCTGCCACCACATCCCTGCCAGTGTGATCCCATACTTGGATTCCGTGGTTAC
AGCTTCTGTAGTTCATGCTCACATGCTTACCATCCTGCCCGAAAGTGCTACTCTTAGGGG
CTTGTGTTGAGCTTGTCACCAGGCTGGGCTCCCCTGGGCTCCAGGAGAGTTCCATTTTAG
GGCAGCTGGGGTCCTTTCCTATCAGTGGCCTTGGTCAGGGTCACTTCATACCACACAAGA
GAGTCCTGTATTTTTGAATATTTAATCAAGATTTGGGGTCTTAATCGCTCCTCTTCTTCC
CTACCCCAACCAGGTTCCTTTGCCAAACTGGTTCTACTTCCTTTCTCAGGAGTGGCAGCT
TTCAACAAGAAACCTACCCTAGGACGCTGGGTCCCTGCTCACCTCACTTTTCCATATGGA
AGAGAGGTCATTGGGCAACTCTAACCGGAGCTTAGATCAGTTCCCAAGAGACTGTCTCCA
CCTGGAGGCCTAAAAAAAATTAGGCATTATTGAAAATTTAGTTGGGATTAAGCCTGTTAA
TGATTTGGGGGCAAGATTTTAATTATAAAATGAAGGATTTTAAGCAGGATTCAGGCTGTA
GTATGTGTTTAGTGCTGTGTTATCATCCTCCCTGCTCAAAATAAGGTTGTTTCCTAACTA
TGCTATATCCTTGTAACAGCCAGGGATACTTGGTCTCATACATGTTGATTAAAAAATTAT
TGGCAAAGCCCCAGGAACCCCACACAGCCACATCAGCCGCTGTGTCCTCTCCAAAGCCAA
GAAGTCTGAGTGTGCCAGAAGCATGGGCCAGCCATGGCTACAGAAACTAACCTTGTGTCC
TGTGCTGTTAATAAAAATATTTTGGATGGGGCGGGCATTGTGGTGTAGCGGGTTAAGCTT
CTGCCTGCAGTGCCAGCATCCCATATGGGCACTGGTTCGAGTCCTGGATTTGAGTTCTTG
TGAATGATCAGCTTAGACTGTCTGAACTATAAAAAGAAAATATGTTGAACTAAAGAAGAA
AATTTCTCATCCATCCTCACTCTTCATGTGTCTGTCTCGCTCATGTCTCTCAATCTCTCC
ACTGTTCCTGTCTTAATTTGGTTTAATTCCTCACACAAGTTTCCCAAGTTGGCCTCTACC
TGCAAGGGGCATGCCCAGTATCTGGTCACAGACAGACCAGACACTGCCTCTGATGCCTGC
ATCCCATGTGGGCACTGGTTCAAGTCCCAGCTGCTCCACTTCTGATCCAGCTCCTTGCTA
ATGCACCTAGGAAAGCAGTGGAAGATGGCCCAAGTGCTTGGGCCCCTGCACGCATGTTGG
AGACCTGGAAGAAGCCCCTGGCTAAAGTCTTTGGCGTGGCTCAGCCCTGGTTGTTGTGGC
CTCTAGGAGGGCCTGAGCCAGTGGACAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved