Oryctolagus_cuniculus Locus Mono:125:SNORA51
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:125:SNORA51
Oryctolagus_cuniculus
Mono:125:SNORA51
scaffold_1479
SNORA51
1001..1118
2118
AGAGAAGGAGAAGCACCTGGCTCCTGCCTTCGGATCAGCACGGTGCGCCAGCTGCAGCG
CGCTGGCCGCTGTGGCCATTGGAGGGTGAACCAATGGCAAAGGAAGACCGTTCTCTCTGT
CTCTCTCTCTCACTGTCCACTCTGCCTGTCAAAAAAATAAAAATAAAAAAATAAATAAAA
AACCCACATATATCAATAACTTCAATCATAAAAGCAGAAAGGAGCTCACAATATAAAATA
GATTGCTAATGCTGTAAGTAAAAGTAAATAACTTAGTAGGAGTAACAAGAAAATCACTAG
AAGATATAAGGGAGTTTGGTGAAAAAGAATTCATTTCAATCAGGTTTAAAATTATTTGTA
AATAGTGTCTTAAATCATGAAGAGATCATTCTACTTACAGTATATTATAAGAAAGTTGCC
AGTGTTTAGAAATGCATAATGGAAAAAAATTTTTAAAAAATAACAATTTAAAAAAGAAAA
CAACAACAACAATAACAAAAATTAAATGCATAATGGAAAATTTCACACATCAATGGCTAA
ATTCCAGAAAGATAAAAATGATATGTGGAATCGAGTACACCATGGCAAGCACTCTGAAAA
ATTGTAGACATGAAACTTTCCAGAATTTACAGAACTTTGAGCAAGTTTGTGATACCACAA
TGAAAATGCAAACCAAGATTGCCACAGCTCATATTATCACCATTGGCTTACTATGATGTT
TGTGAACAATACGGGGTATAACAATAGATGCAAAGGCAATGAAAAGAAATGTACATGTTA
TGGAATAATGTATGTTGTGATTACTCCAACAAGAAATGAATAATAATGTTGTGAAAAGCA
GATAGAGAACTTTCTGTTGTACTTCATTGCAATTACATCTATATTGGAGAATATGAAAAA
AATACCAAAAACATGATTGAAAAAAGATTTTGCCTTGTTCTACCATATACAAAGGCACAG
ATTTCCATATCTAGATTATGCTTAGAGACACATTAAAAATTAGCCTCCTGGTGCTAACCA
CAATCTGTTCTTACACTGACTGTATAGAAAGAGGAGGCAGAACAGGCTCTCCCTCAGGAC
TCATCTTGCCTGGGCTGTATTGTGAATGGGGGGACAAGGAGTTGAGAGGACTGGCATCTG
GCTTGTCCCTGTTTCCTCCAGGCTGAGTGGGGGCCACGAGGGCTGAAGTAGGTGCTTTGT
GGCTTTGCAGCAGCGGAGCCAGGGCAGGGCGGGACTGCATCTCTGCAGGGAGTGGCATGG
CTATCACTTTTCTGAGGTGGTGAAGATCATCAATGACAAGGCCACATAATGCTGCCTCGC
CCAGTTCATCAGAAACCAAAAGGAGTTGAATGAGGACAAGTTGGAAAAGCTGGAGGAGCT
AACAATGGATGGTGCCAAGGCCAAGGCCATTCTGGATGCCTCACGGTCCTCCATGGGCAT
GGACATCTCTTCCATCGACTTGATCAATATCGAGAGCTTCTCCAGCCACATGGTGTCATT
GTCTGAGTACCACCAGCTCCAGCTCCTACACACTTACCTGCGCTCCAAGATGAGCCAGGT
GGCCCCCCAGTCTGTCAGCTCTCACTGGGGAAGCGAGTCCTGAAGACACGGGGTAACACA
CCCAAATACGGACTTATTTTGCACTCCACCTTCATTGGCTGAGCCACCTTGAAGGACAAA
GGCTGCATCTCCTGATACCTGGCCAACAAATGCAGTATTGCCTCACAAATAGATTGCTTC
TCTGAGGTACCCACAAGTGTATTTGGGGAGAAGCTTCTCGAACAAATTGAGAAGCAGCTG
TCCTTCTATGAGACTGGGGAGATTCCACGGAAGAATCTGGATGTCATGAAGGAAGCCATG
GATCAGGCAGAGGCGGCGGATGTGGAGGAAGCTGGAGAAGCAGCAGAAGAAATGCTGGAA
GAAGGAAAAGAAGGCCCTGGTGGCGCTCACCCTGGCATCTTCAGAGAACAGCAGCAGCAC
CCCGGAGAAGTGCGGGGAGGCGCAGGAGAAACCAAGAAAGAAGAAAAAGCAAAAGCCCAG
GAGGCTTCTCAGGAGAACGGGATAGAAGAGCCGTCTGTCTCTTCCTCCAACCCCAAGAAA
AAGATATATTTTTCCAAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved