Oryctolagus_cuniculus Locus Mono:145:SNORA38
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:145:SNORA38
Oryctolagus_cuniculus
Mono:145:SNORA38
scaffold_126134
SNORA38
1001..1126
2126
GAGTTAGTGAGAGAGAGAGAGAAAATTATAGACAGTGAGAGTGAGAGAGAAAGAGAGAG
AGAGAGAGAGAAAGGTCCTCCCTCCGTTGGTTTACCCAAGTAGCCACCATGGCCGGCGCT
GCGCCGATCCGAAGCCAGGAGCCAGGTGCTTCTCCTGGTCTCCCATGCGGGTGCAGGGAC
CCAAGCACTTGGGCCATCCTCCACTGCACTCCCGGGCCACAGCAGAGAGCTGGACTGGAA
GAGGGGCAACCCAGGACTAGAATCCAGCGCCCATATGGGATGCCGGCACCACAGGCGGAG
GATTAGCCAAGTGAGCCACGGCGCCAGCCCCAAGCTAGGGCTCTGATCCCCACAGCTTTG
TCTTTCCCCTCTAAGCCACCCCCCGGGTCACGCAGGAACAGGTTCCTAACACATGAATTT
CCAGCCACTATCCTTAACATGCACAAGATAGCCTTCCTCTGCCTGCTCTCATCCCCCGCA
AGCCCCTTCCACCTTCCACCTACCTCTCAGGGTCAGGAACCTCAGAGCTCCAGGTCCCAC
TGCTACAGCCCCGCCCAGCCCCCAGGCCGCTGAAGCCGGGTCACAGACAAACTGCCGTCC
AAAGTGGACAGGGGCAGAGACCTCCACAGGAACTGCACCTGAGGACGTGCTGCAGCTGGG
GGTGGCAGCCCGAGGTTACGGACTCCGGCAGGCGCGGGTGGGGGCAGGGGCGCCGCTGCT
CGGGCCGCCCTCATCCCAAATCGGACTGTTTGAGTTCTGGCTACTCGGCCTGGCCCAGCC
CCGGCTGTTGCAGGCACTTGAAGAGCAAACCAGCAGAGGGATGATCCACCACATCTACCT
CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTGCGCGCTCGCTCCGCCCCCAGCGGAT
CCAATCACGGGAGTCGTGGGGACTCACTTGTGTTTCACCTCCAGGATTCCAGGCCACTGG
GACACTGGAGAAACTGCCTCCGTGCTTCTGGCACAGGGAGGCCCATCTAAAAAGGCACGT
CTGTGGTTCTGTCTGTGGACACGAAAGAACTGGAAGCAAAGAAACGTGACCGGCCAAGTT
CTGGGGACGGCTGCTCCCGGCAGGCTCAAGACTGCCCGTCACCGTATTTCATTCGCGTGA
GAGCCAGAGAGAGCGCTCCCCCACCCTGGCTCCCTCCCCAGGCGCCTAGACAGCCAGGTC
AGGGCAGGCCAGGTGAGGCCAGCAGCTGGAACTCGACCTAGGTCTCCTGGGAAGGTGGCA
GGGACCACATCACTTGAGCCATCACCTGCTGCACTCCAGTGTGCACCTTAACAGGAAGCT
GGAATCGGGAGCTCAAATCCAGACGCCCAGACCTGGGAGATGGGCGTTCCAACTGGAATC
TTCACTGCTATGCCACATGCCAAGCCATTTTTTATCATCTATTTATTTGAAAGGCAGAGT
GACAGAGAGAGGGGGAGGGACAGTTTCCATCTGCTGGTTCACTCCCCAAATACCTCCAAC
AGCCAGGGCTCGGCCAGACCAAAGCCGGAGCCAGGGCCACTGTCCCTGGCTCCCACGTGG
GTGCACATGGGTGCCAGTCCTCCGCTGCCTTCCCAGGTGCATTAGCAGGGAGCTGGATGG
GAAGCAGCGCCCCAGGACTCAAACCGTCACTCAGGTACGGGGTGCCCGCGTCACATGGAG
CAGCTTAACCTGCAGCCCCAGAGCACCAGGTCCTGAGCCGTTTTTGAGAGAGACCATTTT
GCCAGAGTCTAACCTGCCGGGGTTTTCTCAAAGCCTGAAGGAGTTGGGTGGCGGCAAGTA
CGCAACTCTAAGTCCCTCGGGTCAGCCTGTCCCACCTGACGGCAGGGAGGGGAGACTAAG
AGCACAGGCAGAGCCCAGGGACACGGCTCACCACGAGCCTGGGACCTAACCACAGGATTG
CAGACTCAAGTGAGAAACCAACCGAGTGAGCCCTGCTCAACAAGCCAGAGGAGCAAATCC
ACGGCACTACCACTGCGTGCACAAAAGCCTGACAAAGTCCTACACCCAAACTCTCAGGAG
GGGTGCAGCCTGGCGGCTAGGAGGCCAGTTAAGCACCCGCGTGGGAGACCCGGCAGAAGC
TCCTGGCTCCAGGCTTCGGATCAGCCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved