Oryctolagus_cuniculus Locus Poly:20:SNORD116
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Poly:20:SNORD116
Oryctolagus_cuniculus
Poly:20:SNORD116
scaffold_181458
SNORD116, SNORD116
1001..1094, 3720..3813
4813
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTGTGGACCTTGTCA
CTCTGGCCAGATGTCGGTGCCCATCATGATATTGAAGGCTCAGACACCAGCAAAGCAGTG
CCGGCAGGTAGATGCCAAAAATGTTCAGGCAAAGGTCATCAATGGCAGGACCAATACACA
CTAGGGACATGGACACTTATGTACCATAACTCGCAACTTCCCAGAATTCAGAACTCAAGC
TGAGAACCCACAGCAGCACACTCAAGAGAAACTTGTATAACCAGAGTTCATCATGGACAG
ACTGGCTTGTGTGAAAGGAAGGTTCAGAGATGAAGACTGAGGGGATGTGCTGTGGCGCAA
GACCAGGGTCATCCTAAGCATTGCAGGTCAGAGCAGGCCATGGATCTGTTTTCCTCAAGC
GTGCCTGTGGTTTGTGTGTACTTCTCAGGACTGCTTGCTGATGTCAGCGTGGCCGTGCAG
GTGGGAAGAATTGTGCTTCAGCTGAGGACTTAAGGCCCTACAAGACAATAGAATTCAAAC
TGCCCTTGGTGAGCGGGAAGCTCCTGGATCTCTGAAGATGGTAAGCATTTCCAGGGCCAA
TCCTGGGGACAAAGCCCATAGTACTTCACAGGCCAGCAGGCTTTTGTATGCTCGATGGAG
GCCTTGGCTGCACCTGTGCCACACCTCTGTAGTGTTCTGCCTGTCCTCCTTGCATTGGGG
GGTATCCCTGGACTCTGAAGGGCTGCAGAGGTGGTTGGGCGGAGCAGCTGATGAAGTACT
AGGCCTTTGGTGTTGCAGGCCCCACCCATTGGCATGTGCTTGGATCAATGATGACTCCCC
CATAAACATTCCTTGGAAAAGCTGAACAAAATGAGTGAGAACTCACAACCGTCGTTCTCA
TCGTGACTGAGGTCCAGCACATTGCCTCTGGCAGGGACTATGGCAGTGAGGGCCCACGAT
TAGGGTAGCAGTTCTCTCCAGAACCCAGGGGGTGCCCATGGTGAAAGATCCATTTGAGCG
GCGCCAGCAAGGTGATCTCTCATTCAGCCGCTCTGGGCAGCAGAGTGCCTGGTGCAGTGG
TGCTGGGAGTTTGCGTGGCGGTTCCCAACATGGGCAGCAGTGGTGAAGTATGCAACTGGG
TGTGCACGGTCTGATTGTGTGGATGGATGTGGAGCCAGGTTAAAACCTCTAAGGTCTGAT
AAGTGTGGCTTAGGTCCTTGTTTTTTATGCAGTGGTTCCTGGAACTGTGTGCTCCTCTTC
TTTGCCAACAGACACACAAAGCCTGGTCACCTGGCTAGCATTAGGTCTCTCAGCTGGTGG
ATTGATGTGGTAGCACAGTGCCTGTGGGCTCTGAAGAGATCAGACATCCCCTTGAGTGTG
GCATTGACACTTGGTGTTAGTGCCTGTGTGACCTGGTGGTAGGAGTCAACCTGGCATGAA
TGTTGTTCTGCTTCTCTTGGAAGAGCCTTCCACAGAGTAGAGTGGCTCTTGGGCTGGGTG
CAAAGGAAATGACAGGGACAATGGGATGGGTTGTCTCTGAGGACACCCTGGTGAGCATGA
TTGCTGTGAGTTCTCGTGGCCGGGAAGAAGGTTAATCCTTGGAGCTCCCAGAGTGATTCC
CAGTGATGTCACAGTTTGATCATGCAGTAGAGTTTAGGCACACGACTGGTACAATTTGGT
TGGTGCCTTGGTGGGATTCTAGGCAAGTAATGTGCCGGGATCACTTTGCTGAGGGTGTGA
GTGCCACGTAATCTGTTGTACTCTTGCCCATGGATAAAGCGGGTTTGCAGGTCTGTGCTA
GAAGGCCCGGGTACAGTACAGCGTTCTCTTAATTGAAATGCACAAACCCCTTTACCNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNGGCTCTTCCCTAGACATTTCACAGTGCTCGTCTCTCAACATGTGAGGCATGTGCTT
GGATCGATGATGACTCCCCCATAAACATTCGTTGGAAAAGCTGAACAAAATGAGTGAGAA
CTCACAACCGTCATTCTCATCGTGACTGAGGTCCAGCACGTTGCCTCTGGCAGGGACTAT
GGCAGTGAGGGCCCACGATTAGGGTAGCAGTTCTCTCCACAACCCAGGGTGTGCCTAAGA
TGAAAGGTCCATTCGTGTGGCTCAGGAAAGCAATCACTCAGTTGTCCATATGGGCAGCAG
AGTGCCTTGTGCAATGGTGCTGTGAGTTTGCTTGGCAGCTATCCATGTGGGCAGCAGTGG
TGAAGGATGTAGCAGGGTGTACAGGGTCTGATTGTGTGGATGTGCCCAGGCCACTTATAT
CCCACGAAGGTCTGCTGTGTGTGGCAAAGACCCTGGTCCCTGTGGGGTAGATCTCAGAAT
CAAGTCTTCTCATCTTGGCCAATTGGACCCACGAAGCCTGGTCCCCGGTCTAGCTTTAGG
TCTATGAGCTGGTGGTCTGATGTGGCAGCAGAGTTCTGCAATGGTCTGAAGAGATCAGAC
ATCCCCTTGAGTGTGGCATTGACACTTGGCGGTAGTGCCTGTGTGACCTGGTGGTAGGAG
TCAACCTGGCATGAAAGTTGTTCTGCTTCTCTTGGGAGAGTCTTCGGCAGAGTAGAGTGT
CTCTTGGGCTGGGTGCAAAGGAAATGACAGGGACAATGGGGATGGGTTGTCTCTGAGGAC
ACCCTGGTGAGCATGGTTGCTGTGCGTTCTCGATGTGTGGCACCAGATTCTCTGTGGAAT
ACTCAGGATTATCCTTGGGTGATGTCAGAGGTAGATCCTGCAGTGGAGCTTGGCACACAT
CTGGTGCATTTAGGTTGGTGCCTTCATTGAGGGATTCCAGGCAAGTAATGAGCCGGGATC
CCTTTGCTGAGGGTTTGAGTGCCACGAAATCTTTTGTACTCTTGAGCTTGAATGAAGAAT
GTTTGCAGGACTCTGCTACAAAGGCTCAGGTACTGTGCTGATCCTTTTGAAATGGACATC
TCTCTTTACCTGTGCTTCCAATGCAGGAACAGTGAAGTGACACAGTTAACTCAGGAGAGT
TAGGACCTTGGGCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved