Oryctolagus_cuniculus Locus Mono:70:SNORA72
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:70:SNORA72
Oryctolagus_cuniculus
Mono:70:SNORA72
scaffold_99305
SNORA72
1001..1132
2132
ATGTTTACAACACTGCCAATTTCTACCTGTTTCTTACTTAGAGTCTAAAGGAGTGGGTT
TAGGTAGCTTTATGAAAATAGAGGCGCCATTGTGCTTCCTTACCAAGATCTTTATCCTTA
CACCTTCTAGTGATATGACGCCTGTGAGACCTGTGAAGTGTTCAGTGAATGAACGACTGA
ATGTGTACGTGGATGGCTGAGCAAACAGATGACATTTTCATGTGAATGAATGACTGTATA
CTCAGCATATTTATTTAATTGGGAATGGAGGTTAACACTCTGGATTCTTTGACTTAAAAG
AAAAGGTAACAGAGGGTCCAAGTAATCAAAATCCTTAAGAGAGAAGAGGTCAGGTTCTTA
TTCAAATGTTTTCTCATTTAGGTAATTGTCAAAGTTCCCATGAAGTTACTGCATAGCACA
TGGTTTGAATTTACAAAGCTTTTCTTTAATGGTAGAAATATAAAATTCCATAGAATACTG
CTTATTATATTTGCTCATTGTGAACTACAGTTCAAATGGCATATAAACATGGATAAACCT
GGTTCTGCATAGTAGAAGTACTCCCACGGGTTCTTTTATTTTTAAGATGTATCTTTTTCT
CCACTCTTTCAGTTTCTTTTTTGCTCCTGTGAGATAAGAAGCAAAAATAATGAGAGACAG
AAAGAGGGAATTTCCAAATCATTTTCCATTGATAAATTATTTTTTCAAGATCATTTAAAA
TCTTCTTGCAGTTTCTTTTGTTTGAATGGTAAAAAATAAATTTGAGGCATACAGGTATAA
TTAATTTTGATGAGTGGAAAATGGGATATCTTTGCTTGGAATAATCCAGGGGAAAACAGA
TTAAACAAGAGTGGCAAAAATGTCACAGGTGGTTGTCACAGGTGGTGATGGGTATGCATC
TTCTCTATATTATTTTCTCTTTGCACATGTTTAAAATTTCCAGTCAAATATAAAGGAAAA
GAAAGTCGAAAGTTAAAAACAGAGTATTAAAAGAAAAGAGATTGAGAATATTCTCGCTGC
TCTGACTTTGTAATAATTAGGACAGACTAAACATTCGCTATATTAAGACCATACATGTAT
CCCCAGGCCTAGTTCTTTCCCTGTGTTTGGTTTTATAAATGTTCCTGATAAAATAAAAAT
AAAAAAAAAAAAAGAGAGAAGAGAAAGTACAAAGCAAACGTATTCATGGCAAGTTTGAAC
AATTGTAGATTTGAATATAGAATAAACTGTGAAAAACCACTAAGGTCAGAACAAGAAAGA
ACAAGCTTTTTTTTTTTTTTAAGATTTAAAACACCCTGACATTCCAAACTCCTCATCCAT
GCCTCCAATCAGAGCTGTGCTACATGATAATAATGTATAACTAATGAAAATTAAGATATG
ATATTTGAAAAATTAAGTTAATGTAGCTCAGTGCTAGTCATGGCAGGTAGTAGCCTTACC
CAGGATCCATTCAGTATCCTCTCTTCCTTTGCCAGTTTCAACTTTATAAGGCCTGAAGCA
AAATTCTTTTTTCCTTTTGTCCCTTGTGACACAGTTCTGGCCAAACAGGTGTCAATAGGA
GTCCCTAAAAGGGACTTTAGGAAGAGTTTTTATTTCTCTGTTAATAAGAGGCAGGTTCAG
CTTTCGTCCTTTTCTCCCCTAGCTCCCTTCAACCTAATTCATTCCCAGAGACTAAACTTG
AAGCCTGGAGAGGCAGCAGTCATTTGGTGACTAGACAGGGATAAGAGCAAAGATAAGCGC
CTGTGTGGTAAGGTGGATGGGGCAGACAGAGTGACTGGACTTCTGTTCTTGCCAGGATCA
ACCCTGAGCTTTCCCTCTGGGCTTCCTGTCACCTGAGAATAAAATAAAAATGTAATTAAT
ACAAAAAATGGAAGCTAGATTAAGAACTCAAGACACAAATTCAAAGGCTGTTCTCTGGTC
CTGGTCCTGGCCCTATAACTTACTCATTGTGTGAGGTTGATTGTGTCACAGATTTCTATC
TCCTCTCTGAAAGTCAAGAGAAGACATGATTTTCCTAGCCTACAATTATCCTATGAATTG
TTTGTGATACAGCTTCATGAATTGTAAGAGATTACATCGATATAAAGTATTGCTTATTGA
ATATGATACAGGTGCTGCACTGTGAAGCCACAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved