Oryctolagus_cuniculus Locus Mono:16:SNORA26
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:16:SNORA26
Oryctolagus_cuniculus
Mono:16:SNORA26
scaffold_200751
SNORA26
1001..1121
2121
GAATACTGTAGAAAATAAAACTCCACCAAAAGCAATTTTGGATGCACTTTTCTTCCTTA
TAATGGAAAGAAGCTACAGAGAGCTTAAGAGGGAAGAGAGACAGAATTTAGGGAAACTAG
CAGGATATGATCCAAAGAGAAAGTAGGAAGGAATGAGGGCCAGAGGTAAGACGGTAATGG
ACTCATGATAATCAATGGTAAGAAGGAATACGGGGTAGGAGGTGGAACTAAGAGACCTCC
AAAATACCCACTCACTTCACTGAGAGAACAGTAATGCAACTGACAAAATGAATCCCCAGG
AAATCAGGAAGGGATTTGGTTGGAGGGAGCGAGATGAGTTTGTTTTAAACACGTTCAGTT
AGAGCTAATAGTGAAGATGCAATGAATAAATTCAATTAGGACGTGTTTATTTGGAATTTA
TCATCTGTTTTCTTTTTTTTACAGATTGAGGGGCACAGCACAGCAGGTTAAGACAGTGTT
TGAGATGCCCACATCCCATATCAGAGTGTCTGGTTCAAGTCCTGGCCGCTGTTTTCCTGA
TCTACCTTCCTGCTAATGCATCTGGGAGGCAGCACATGATGGCTCAAGTACTTCAACCCC
TGAACCTTCAGGGGAACGAGACCCAGATGGACTTCCTTGCTCTGACCTTGGCTGGCCCAG
CCCTGGCTGTTGCTGGCGTCTGGGGAGTGAACCAGCAAATGGAAAATATTCTTTCTCTCT
CTCCCGCCCCCTTCTCTTCTTCCTCCCTTTCTGTCACTCTGCCTTTCAAATGAATAAACA
AAGCTTTTTTAAAAAAAGATTGGAGTAGCTTAACTAAATTCAAAATAACACAAAGTACAG
TTATTTTTGGAATGACAGCAATTCAAAAGCCCACAAAAAAACAATTAGGGAAATAACAAC
TACTAGATATTAATGAGTTAATTAAAAAACAACTGGAAATTCAGAAATGGTGCTCAAAGG
AGTGGTAGGTTTAGAATGATATGTGTAAGCCACCCTTTCCTGTGCCCTTTTACAGCTAAC
ACAGTGCTTTAAGAGGCTAACACAGAAGGGGAAACTAAGTCTCCACAAAACCCAGAGAAG
AGAGTGTGACCTCTTCTTTGGATCCTGTCTGGAGTCACAATTACAAAAAAGAAAAAAAGA
ATGATGAGTATTAGGATACATCTGCTTTGTTTTCTCTATTGTCCTTCACTGTCAGCTGTC
CTCTGTCAGTTTCCTGGTCCTTTAGATTGCTTTAAGTTTAATTATAACAATACTCAATAT
AAAACCATCCAAACTTGGAAAACACTCACGTAAATGAAACAATAAAACACATTCATAATA
TTAACACTCTTTAAAAAAAAGAAAGAAGCGTTTATTATTTAAGCCATCCAGTTCATGGTA
TTTTGTTATGGCAGCCCTAACTGAACAAGACACAGCCTAACAGAACCCTTCTTGGTATAT
GATTACAAATCATGGTCTCTTCACCAACTACTGGGCTTGTCACCTGTCCCATAGGGAATT
AATATGTCACTTTCTCAAGGTAAGACTCCCTTGACTTAAACCACATCTCTTTTTAGGGGG
TGCTTATGAAAGATTAAACAAAAATTCTCATTATAACATTTAGCACAATTCATAGGTACA
TATCTATGTGACTGCATCATATCTGTCTCACTCCTTGAGGTATAAATGCCAAGCTCAGAT
GAAGAAAGTCTTTTAATTTGGTCTTTGTTTTTTTAAGATAACAAAGAAAATATCTCAAAC
AGATAGACCTACGTAACTCTTCAGAAAAAATACCAACTCCCTGTCCATTGTAACACCATT
TTCAGTTTCCCAGAAACAACTACATCTAATTTTTGTAGACGAAATTCTAGAGATTTTTAC
TATAATGACACATAGTTACATATGACTTTTGGCTTAGGAATTGTTATTGACTTTCCTCTT
GAGAAACAGGGTCCCGCGACACGTACGGCAAAAACACTCTCCATCATCCAGTTCTCTGAT
TACAATACCAATTATAATAACTATTATTAATACATTATTACTGTTACAAAGGACTATTCT
CAGATGAGTCACATCCTGGTAGACATTCTATTAATTTCCTTTTTTTTGAAAAAAATCTCT
GAGTCTTCTAACCGGTTCCATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved