Oryctolagus_cuniculus Locus Mono:194:SNORA26
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:194:SNORA26
Oryctolagus_cuniculus
Mono:194:SNORA26
GeneScaffold_4880
SNORA26
1001..1109
2109
TTGGAAAGAAGGGCAAGGGCCTGTTATGAATGTACCATATCTCCCCAATATTCATTTGT
TAAAGACTTAGTTCCCAATGTGACTGCACCTTTAACAAGATAATTAAGGTTAAAGGAGGA
TATAAGAGCAGAGCCACAGCATAGAGGGTAAAGCCGCAGCCTGCAGCGCTGCTCCACTTC
TGATCCAGCTCTCTGCTATGGCCTGGGAAAGCAGTAGAAGATGGCCAGGTCTTTGGGCCA
CTGCACCTATGTGTCAGATCCGGAAGAAATCTTCTGGCTCCTGGCTTTGGATAGGCCCAG
CTCTGGCTGTGTGGCCCTTTGGGGAGTAGACCAGCAGATGGAAGATCCCTCTTTCTCTTT
CTCTCTGCCTTTCAAATAAGTAAATAAATCTAAAAAAAAAAAAAGGCAGAGCCCTGGGTC
TGAAAGAATTTATGTCCTTGTAAGAGGAAAAAATACCAGGAGTGCACAAGCAGAGAGAAG
AGAAAAGGCCATCTCCCGGATAACAAGAAAGGCCTCCCTGGAAGCCAATTCTGCTAGAAC
CTCGCTCTTGGACTTCAATCCTCAGAACTGAAAGAAAATAAATTTCTGCTGTGAAGCCAC
ACTGTGGTATTTTGTATGGTAAGCCTTAACTGCAAAGTAGTCTTGAAAATCACACAAAAA
AATTTGGCTATAATCTCAAACCTTGAATTTCTGAAAAGTAGGTCCAAATGCGCTTAAGAT
AATCAAGTGTATGTTTTAGAAAGGCAATTCTAGTGGTCTCTAGGAAAACCTAGAAGAAAA
CAAGACTATGCCACATACATAAAATACTAAGAATTTTTGGGGGGGCCTAAACAACTTAAA
AATTGTCTTTAAAAGATACACAACTAAAGAATTAATATGTACACTTAAGTGCCTCTCATA
AAAATGTGATACTGGCCTGTAATTGCATTAAAAGATGCCCACAGACACAAGCAAAAGATA
AAAATGGGAAGGAGTAAACACAGGGAACACTACTCTTTCCTGTGCCCTTTTGTTAGAGCT
GACAGAGTGCTTTAAGAGGCTAACACAGAAGGGAAAATAAGTCTCCATAAAACCCAGGGA
AGATATTGGACCCCGTCTGCAGTCACAGCTGAGGGGGAAAAAAAGAGACAAGTGTACACT
CATCTTAAATTTATTTTAGAAGAAAGACAACAACGACTTTTTAAAAAAACTGAGCACCTA
GCACTACATTCCGAACACAACTTTGTTTTATTTGTTTGATATTACTTTTACTCCTCCTTT
TCTGTCACAGATAAACTGAAGTTTGTGTCTCAATAAAACTAATCTCCTCTGCTTCCACTC
TTTACCAGCATTTTAAAAACTTCAAAAAGGTTAAGAAATCAATTGAGGGGCTGGCATTGT
GACATAGCAGTACAGCAGGTAACTGCCACCACCTGCAATGCCGGCATGCCACATGGACGC
TGGTCAGTGTCCCCACTGCTCCACTTCCGATCTAAATCCCTGCTAATGGCCTGGGAAAAG
CAGTGGAAGATGGGCCATGTGCTTGGGTCCCTGCCACTCACGTGGGAGACATAGATAGAT
TTCCTGGCTCCTTGCTTCAGCCTGTCCCAGCCCCAGCTGTTATGCACTTTGAGGAGTGAA
CCAGTGGATGGAAGATCTCTCTCTTGATCTCTCTTGATCTCTCTCTCTCTCTCTTTTGTA
ACTGCCTATTAAATAAATAAATCAGCCTTAAAAAAAAAAGACACTAAGATATTCTTCTAT
ATTTTCTTCTAGTATTCATAGTTTTAATTTTTAGCTTTTACATTAGATCTATTGTCTTTT
TATTTTTATTTTATTTTATTTTATTTAAATATTTATAATATGTATTTGAAAGACAGAGGG
AGAGAGAGAAAGACCTTCCATGCCCAAATGGCCATAACAGCTGGGGCTGGAACAGGCCGA
AAACAGGGGCCAGGAAGTCCATCCAGGCCTCTCATATGGACTGCAGGGCCCAAGTACTTG
GACCATCTTCTGATGCATTCCAAGTGCATTATCACAGAGCCGTATCAGAAGCAGCTGGGA
TTAGAACTGGTGCTCTAAATAGGCAGTGGCTTAGCGTGCTATACCACAATGCTGGCCCAC
TATGATCGAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved