Oryctolagus_cuniculus Locus Mono:2:SNORA70
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:2:SNORA70
Oryctolagus_cuniculus
Mono:2:SNORA70
scaffold_208782
SNORA70
1001..1136
2136
GAACTCTACTCTAAAAGAAATGTGCCTCACTGTCTTTAAGAATAAATTTATTTATTTAT
TATGTGAGAGGAAGAATCTCCCTCTCTCCCAAATGCCTGTAACAAGCAGGCGTGGGCCGG
TCTGAAACCAGGAGCCAGAAGCTTGAACTGGGTGTCCTACATGGGTAACAGGGATTCAAG
TACTTGAGCAATCACCTGCTGCCTCCTGGTATATGCATTAGCAGGAAACTGACATCGAGA
GCTGAGCTGGGACTTGAACCTAGAGACTCTGATTATGAGATGCAGGCATCCCAAGCAGCA
TCTTACTCACTAGGCCAAACATCCCACCCCACCCCCAACCCACTCCCCACTTTTTTCTCT
TTAAAAAATTACATATATTTAAGGTACACAACATGATATTTTAATATGCACATACAAAGA
GAAATAACTGCTGAAGTCAATTATATTATTTCTCATTTGCCATAGTTACCTTTGTGTGTG
GTGGGGGCAGAGGGAGGAGATAGTAAGGATCACTTTCTTTTCTTTTTTTTTTTTTTTTTT
TTTTGACAGACAGAGTGGATAGGGAGTAAGAGAGACAGAGAGAAAGGTCTTCCTTTTGCC
ATTGGTTCACCCTCCAATGGCCGCCACGGCTGGCACGCTGCAGCTGGCGCACTGCACTGA
TCCGAAGGCAGGAGCCAGGTGCTTCTCCTGGTCTCCCATGGGATGCAGGGCCCAAGCACT
TGGGCCATCCTCCACTGCACTCCCTGCCACAGCAGAGAGCTGGCCTGGAAGAGGGGCAAC
CGGGACAGAATCCGGTGTGCCGGCGCCACTAGGTGGAGGATTAGCCTATTGAGCTGCGGC
ACCGGCCAGGATCACTTCAACTAAACATTAGATGGCAAAGAAGTATACATTTGTAAAACA
TTTTTCCATTCAAAACTCACAATGCCTGAATTATTTTATGATTTGCTACATATGCCTATC
CTGATGTACTATTTTTTTAAGGAATATAAATTTGAACTCATTCACAGCCAAGTAAGCTGA
CAAGGCTCCTGTTTTCACAGGGACTCAGTGTGCAGTTGGCAGCAAACAGCAGCCTCCTTG
CTGGTGCGTACAGTCTGTTACTTGTACAGGTTGCCCTAAGGGACCTTGGAGACAGCCCCT
CCCAGTGGATCTTCATGTCTGATCTAGTACTGCTTCCAGTCTAGGCCCCAGACAGCTATG
TGGGGTGGCTTTTGAAAGCCCCAAGGCACAGTGGCCAGGGTTCACATTGGCAGAATGATG
AACATGTAATTGAGGCCCTATGCAGGACCAAGTTCAAGTTCACGTTTAAAGGGGATGAAT
TCGAAGACATAGTTCTGAGAAACAGCTCATCACAGAATGACTGTATGGGGTCAAATATAT
TCCCAATTGTGCTGCCACGGACAAACAGCAGAACCTGTACTCAACCTGGGCTTCTGCCAT
ACTGCCCCCTCCTCCTTAATCAAGTCAATAACTCTCCATTAAAAAAAAAAATCACACACA
AAAAAACTGAATTTAATCTCTGCTTAAAGCCTGATATGAAGTTAAAATCTTGTGATTTAT
TTTGCATGAAATAGCTGTATTTTTCACATTCTATTACACCATATAAGAAAGACAAGGTTA
AAATGAAAACAAAAATCGAGACCTTACAATTGCACCTATCTTTGGTGACAAAGGTCCTGA
TTTAGAAGGATGGAAAATCCTTGAAATTACTGTATGGGCTCCCCTGATCAGCTGTATCCT
TGGCCATCTATTTTTAATCCCTTTCATATAGCCAGACTGTTAGATCTGGAAGGGACCTTT
GAGGTCATCTGATCCAATGCACTCATTTTTCAAAGGAGGACAAAGCCCAGAGAAGGCAAG
TCCTGTGAGAGATTGTTAGAGCAGCTGACCTGCAGCCAGTTTTCAACTCCCAGAGACATC
CTTCTTTGTTTTCTTTTCTTTTATTATTTTTTAACGTTTATTTATTTATTTGAGAGGCAG
TTACAGACAGAAGGAGAGACAGAAAAAGAGTTTTCCTTCTGCTGATTCACTCCCCAAATA
GCTGCAACAGCCGGAGTTGGGCTGACCTGAAGCCAGGAGCCAGGAGCTTTATCAGGTCTC
CAACATGGATGCAGGGACCCAAGCACTTAAGCCATGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved