Oryctolagus_cuniculus Locus Poly:19:SNORD116
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Poly:19:SNORD116
Oryctolagus_cuniculus
Poly:19:SNORD116
scaffold_181458
SNORD116, SNORD116, SNORD116, SNORD116, SNORD116, SNORD116, SNORD116
1001..1092, 2021..2112, 4780..4871, 6545..6636, 10951..11042, 13642..13733, 16615..16706
17706
CACATGCACTTTCCATGGCAGGAAAAAAACTCATGGTGATTGTAGTCATTGGAGGCATG
TCCCACCAAGATGACTGGAATCCTATACTTGGTGTATAATGGCCTTGGGAACCAGCCAAA
AGTGACCCAAGGGCCTCGCTGCTAGGTGACTACGAGTTGGCTCCTTGGTGTCAGGCTGGA
ATGACATGTGTTCATGATGAAAGCAAGTGCAGAGTTGTGGTGTGTTGACCAGCACATGGT
TAGGTGGACAAGGCATGACACTACCCAAGTTCCATAATTGCCAAACACCATGTTCCTTGT
TTTTTTTTTTTTTTGTTTTTTTGTTTTGAGACTAGCATAGGACTCTGGTGACTGAAGGAA
ATTTCAGCCCACAACACAATGGGGTACAACCACACACATTCCCATGTCAAAAGTCACAGG
AAGAACCACAGGGAGTCCCACAGGGAGAACTCTTGTGTGCCAGTGGATCCCTGTCCACAC
ATAGGATCCTTGAATGGAAAGGGGGCTAGGGATAAAGACTTTGGGCTTCTGAAAGGGAGC
ATTGCGCCATGCCTGGCTATGGATTCGGGCCATGATCTGTACACTGGGTCTCTTGTCTCA
CATGTGCCCCTGGTCTGTGTGCAATTCTCAGGGGAATTGAGATCAGTGGCATTTCTTCTG
GAATGATGCAAGATGTACCCTTGGTTGAGTACTGGAGGCACTGGAGGGCACTGGAATCCC
TGTGTCCAGTAGGAAGCTCCATTTCGCTGGAGGTCTGAGGAAGGTAAGCATTCACAGGAC
CAGAGGCCCTGCAAAACCCCAAGTATTCTGGAGACCTGAGGGACCTGTGTGCTGGCACTC
CACTGATGGCCTGCTGGCCTGCACTGCTCTGGCAGATTGCCTGGCCTTCTTTCTCTGAGC
CATGGACCTGGTCTCCCCAGGCCCATGAAGGTCTTTGTGGTTGCCAGGCTCTTCCCTAGC
CCTGCCACAGTGCTCCTCTCCCAGCATGTGGGCATGTGCTTGGATCGATGATGACTCCTG
CAAATACATTCCTTGGAAGCTGAACAAAATGAGTGAGAACCTCATACCGTCGTTCTCATT
GTGACTGAGGTCCAGCACGTTGCCCCCAGCCAGGGTCCTACAAGGAGTGGGTCCACGTCC
CCAGCCTCTTGTTCCCTCCAGCAGTCAGGTTATCAGGATAGGCAAATCCTGCCACCACAC
AGGCAAACGGAGCCAGTCCTCCGAGACAGTGCCCAGGCCGGGGAGTGCTTGGTGGGATGG
GCATATGTGTGGATGTGGTGTTCTTGCAAGGGGCCTTAGGTCTTGGCAGTGTGCTCACCG
AACCTGTGTCCACTGTGGTGTGAGGCCCAGATCCCGGGGACTGTGTCCTTGATTGTTTGA
GGGGGAGAGCTTAGAACACCAGTTCTTTGACTGGAGGTGGTGCTTGTATCTATGGTCTGC
CTCTGTTGTGAGCCAACAGTGTAGGGCAGGTGGAAACAGGGGCCTTGGTGTGGCCAGATT
CCACTCTGTTACAATGCAGGCAGGGTATGCTCAGGGGCGTGGCCAATTAAGGGCCTGCCC
TTCAAGTCCTGTATCACCATGCCATGCCTGGCTTTGGATGCAGGCCATGACCTGTACACT
GCATTGGTCGTCTTACATGTTTCACTGGTCTGTGTGCACTTGACAGGGGAAATTGATGTT
GGTGGCATTTCTTCTGGGATGATGCAAGATGTACTCTTTGTTTAGAACAAGAGGCACTGG
AGGGCGCTGGAATCCCTGTGTCCAGTAGGAGGCTCCATTTTGCTGGAGCTCGAGAATGGT
AAGCATTTCCAGGCCCAGAGGCCTTGTACCACCCCAAGCAATCTGGAGACCAAAGGGCTT
ATGTGCTGGCTTGCAGGGCTGCGCTGCTCTGGCAGATTGCCTGGCCTTCTTTCTCTGAGC
CATGGACCTGGTCTCCCCAGGCCCATGAAGGTCTTTGTGGTCACCAGGCTCTTCCCTAGC
CCGGCCACAGTGCTCCCCTCTCAGCATGTGGGCATGTGCTTGGATCGATGATGACTCCTG
CAAATACATTCCTTGGAAGCTGAACAAAATGAGTGAGAACCTCATACCGTCGTTCTCATT
GTGACTGAGGTCCAGCACGTTGCCCCCAGCCAGGGTCCTACAAGGAGTGGGTCCACGTCC
CCAGCCTCTCGTTCCCTCCAGCAGTCAGGTTATCAGGATAGGCAAATCCTGCCACCACAC
AGGCAAACGGAGCCAGTCCTCCGAGGCAGTGCCCAGGCCGGGGAGTGCTTGGTGGGATGG
GCATATGTGTGGATGTGGTGTTCTTGCGAAGGGCCTTAGGTCTTGGCAGTGTGTTCTCCG
AACCTGTGACCACTGTGGTGTGAGGCCTAGATCCCGGGGTCTGTGTCCTTGATTGTCTGA
GGGAGAGAGCTTAGAACACCAGTTCTTTGACTGGAGGTGGTGCTTGTATTTATGGGTTGC
CACTATTGTGAGCCACGGGAATAGGTCAGGAGGAAACAGGGGGCCTTTTCATTGCCGCAC
TATGCTGTAGTGCAGGCAGGATATGCTGAGGGATGTGGCTGCACAAGGTCCTGCCCTTCA
AGTCCATGTCACAGGATTACAAAATGTGTTGGAATTGGGTTCCCTCAGGTGAGAGGGAAA
TTATTGCCAGGAAAAATGTCATAGAGTGGTTGCTTGGCACTTGTGCTTTCACGTTTTACA
GTTTTTTCCACCTCATGCACAAGGAGCTCTCTAGAATTTTGGGAAATCTTAGAGATGGCT
GCTTCTGTGGGTCTTTAAGGTCAGAGTGTACTCTATTGCCTATGTTCCCTGAATACTGTT
GGGGATCCCCCATGACTCGCTCTTGCCATGGTGCTTTGCCTTCCAGTCACTATGACCCCA
GCCTTGCAATGCTCCAAACTTGCAAATGTGTGGCATGGGTAGCCAGTTTTCCACGGCCAA
GTTTCATCTCCCCTTTGTCCTGAAGGGACCCACTTTTGGTCATTGCTCTGCCTGGGTTGT
TGAGATCTTCCTCCACACTTTGCCCCTAGGTGCCCCAGGCAACTGCTGAGGTGGGCTAAC
TCAAGCCAAGGTGCTGTTGCCCCCGTGCAGGAGAAAATGGGAGTTGTGGACACGGAGCTG
TGTCCCAGCCAAGATGATTGGAGTCCTGTACTTAGTGTATAAGGGCCTTGGGGGCCAATC
CCATAGGCCTCACTTCAGGCTTACTGTGAGTTGGCTCATTGGTGCTAGGCTGGAGTGGCG
TGTGTTTGTGATGAAGGCAAGTGCAAAGCGCCAGGTCATGGTTTGTCAGCCAGCACATGG
AGAGGGGGAGAAGTCCTGACAATACCTGAGTAACTTAGTTTCCAAGCACCATCTTCCTTT
ATGATTTCTTTCTTTTTTTGACAGGCAGAGTTAGAAAGTGAGAGAGAGAGAGAGACAGAG
AGAAAGGTTTTCCTTCCGTTGGTTCACTCTCTAAATGACCGCTTCTGCTGGCGCGCTGTG
CCGATCTGAAGCCCAGGAGCCAGGCGCTTCCTCCTGGTCTCCCATGTGCGTGCAGGGCCC
AAGTACTTGGGCCATCCTCCACTGCCTTCGTGGGCCACAGCAGAGAGCTGGACTGGAAGA
GGAGCAACCAGGACAGAACTGGCACCCCAACTGGGACTAGAATCCGGAGTGCCAGCAATG
CAGGCAGAGGATTAACCTAGTGAGCCGTGGCGCCGGCCAACCTTTATGATTTCTTGAGCT
AGCCTGGAGTAGAACCCGGCTGATGGAAGGCAAGTTTGGTCAAGAAGCAGTTGTTAGGGC
ACTAAAAATGGAGCCTTGTGGCACTGGCCCAGGGTTTCTGAAACCTAATCCAGTCATGGC
TTATGTCACCTTCATGTATGTCTCCTGAGGTCCAATGCAGTAATTTATCACAGTAGCAGG
TCTGGCCATCAGACTTCCTGAATATCTTTGTGTCTGTCTGTGAGGGTGTGTATACATGTG
TTTTGCATGCTGTCACAGGAGGCAGCGGATGTCCCATGGGGAGTCCTGGGCCTAGGTCAT
CACCTTGAAGAGTGTGAATACACGTCTTGCTGATCGAAGGTGCAGAGATCAAAGGGTTTA
AATGAGATGCGCGGGAAGGCAGCCCTGGGAGGTTAAATGCCAGCCCAGGCATCCAGGGAC
CTCAGCTCCACAACACAATGGGGTACAGCCACACACGTTCCCATGTCAAAAGTCACAGGA
AGAACCACAGGGAGTCCCACAGGGAGAACTCTTGTGTGCCAGTGGATCCCTGTCCACACA
TAGGATCCTTGAATGGAAAGGGGGCTAGGGATGAAGACTTTGGGCTTCTGAAAGGGAGCA
TTGCGCCATGCCTGGCTATGGATTCGGGCCATGATCTGTGCACTGGGTCTCTTGTCTCAC
ATGTGCCCCTGGTCTGTGTGCAATTCTCAGGGGAGTTGAGATCAGTGGCATTTCTTCTGG
AATGATGCAAGATGTACCCTTGGTTGAGTACTGGAGGCACTGGAGGGCACTGGAATCCCT
GTGTCCAGTAGGAAGCTCCATTTCGCTGGAGGTCTGAGGAAGGTAAGCATTCACAGGACC
AGAGGCCCTGCAAAACCCCAAGTATTCTGGAGACCTGAGGGACCTGTGTGCTGGCACTCC
ACTGATGGCCTGCTGGCCTACACTGCTCTGGCAGATTGCCTGGCCTTCTTTCTCTGAGCC
ATGGACCTGGTCTCCCCAGGCCCATGAAGGTCTTTGTGGTTGCCAGGCTCTTCCCTAGCC
CAGCCACAGTGCTCCCCTCTCAGCATGTGGGCATGTGCTTGGATCGATGATGACTCCTGC
AAATACATTCCTTGGAAGCTGAACAAAATGAGTGAGAACCTCATACCGTCGTTCTCATTG
TGACTGAGGTCCAGCACGTTGCCCCCAGCCAGGGTCCTACAAGGAGTGGGTCCACGTCCC
CAGCCTCTCGTTCCCTCTAGCAGTCAGGTTATCAAGATAGGCAAATCCTGCCACCACACA
GGCAAACGGAGCCAGTCCTCCGAGGCAGTGCCCAGGCCGGGGAGTGCTTGGTGGGATGGG
GATATGTGTGGATGTGGTGTTCTTGCAAAGTGCCTATGGTTTGGGATTGTGCTCAACAAA
CTTGTGCCCACTATGGTGAGAGGCTCAGATCCTGAACACTTTGCCCCTAGGTGCCCCTAG
TTGACTACTAATGTGGGCCCTTTCTGGCCAGGGTGGGTTTGACCTGGTGGTGGAGAAAAC
TCATGATATTCATGAACAGCAGAGCTGTCTCCATACTAAGGTTATTGGAATCTTATACTT
GGCCTTTAGGGTCTGGCCTGCTGCGCGTTGCTACTGGGAGTTGACTTGTTGGTGTTAGGC
TGGAGTGGCTTGTTTTTGTGATGAAGAGAAGCACAGTGTCATTCACATTGCCATGGTTTG
TCCACCAGCATATGATTAGGGGGACAAGGCCTGATAGTACCTGAGTTCCTTAGTTGCCAA
GCACAGTGTTCCTTTGAGATTTCCTGTGTGCTAGGCTGGTGTAGGTCCCTGGTGACAGAA
GGAAAGCTCCATCAGGAAGCAGTCTTTAAGTTAATAGTGGATGGAGCCTTTGTGGCCCTG
TCCCAGGGTTCTTAATCCTGATCTAGTCTTGGCCCATGTCACTTTCATGTGTGTCCCCTG
AAGACGAACACAGTGAGTTTCCGGGGTAGCAGTTCTGGCTGGCAGACTTCCTGACATCTT
TTTTCTGTCTGGGTGGATGTGTCCACATGTGCTTTGCATGCTGTCTCAGGATGCAGTGGG
TGTTCCATGGGGAGTCTATGGCCTCTGTCATTACCTCCAAGGTTGTCCACACGTGTTGTG
CTGAAGGAAAGTCCTGACCCTGAGCATCAGTAGTCAAGGGATTTGAATGAGATGCCCCGG
AAGGCGGCTCAGGGAGGTTAAATGCTGGTCCAGGGTTCCAGGGACCTCACATTCACAACA
CAATGGGGTACAACCACACTCATTTCCCTACTTGAAAGTCATGTGGAAAACCACACGGAT
TCCCAACCAGAGAAGCCTTTTGTGCCAGTGTATCCCTCTTCACACATAAGATCCTTGAAT
GGGAATGAGGCTGGGGATGAAGACATAAGGCAGGTGAAAAGGGAGCATGTGCCATGGCTG
CTATGAATGCAAGCCTTAATCTGCACTGAGTTCATTGTCTCACTTATGCCCCTGGTCTGT
GTGCACTTCTCAGGGTCAGTGTCGTGTCTTCAGGGGTGATGCAAGATGTACACTTTGGTG
AGGACTGGAGTCACTGGAAGGTGCAGGAATCCCTGTGGCCTATGGTGGGCTCCAGTTCGC
TGGAGCTCTGAGGTTAGTAAGCGTTCCCAGGTCCCAGTGCCCCATATCACCCCAAGCATT
CAGGATGCCTGAATGACCTGTGTGCTGGGTGGCCACTGATGACCTGCTGGGCTGCACTGC
TATGGTGGATTGCCTGGCCTTCTTTCTCTGAGCCATGGACCTGGTCTCCCCAGGCCCCTG
ATGAGAGCTAGGCTCTCCCCTTGCCCGGCCACAGTGCTCCCCTCCCAGCACATGGGCATG
TGCTTGGATTGATGATGACTCCTGCAGATACATTCTTTGGAAGTTGAACAAAATGAGTGA
AAACCCCATACCATCATTCTCTTCATTACTGAGGTCCAGCATGCTTCCCCCTGTAGGAAC
ATTAGGGATATTATCCCATGTCTTTTCCCTCACACTCCTTCCAGCCCTCAGGGTATCACT
AAAGGCAAATCCTCCCCACCACACAGGTGAACAGACCTGTCCAAGGGCTCTGCCCAGGCC
AGTGAGTGCTCGTTGGGATGGTGATACGTGTGTGTGGTGTCCTGGCAAGGAGCCATAGGT
TGGTATTTTTGGTTAGGATGCAGGTTAGGGTCTTGCGGTGTGCAGGCCGTGAGCCTATCA
ATGAATTAGTGACTTTTGTGGACCTGTTCACCAAACCTATGTCCCATGCAACATGCGTCC
CAGATCATTGGGACTGTGTTCTTGATCCCTTGAGGAGTAAAACATGGAGTGCAAGTACCC
TGACTTAAGGTTGCACTTGTATCTATAGGCTGACAATTGTTGTGACCCATGGTGTAGGGC
ATAGTGAAACAGGGGGCCTTCTCGTATCTGGATTCCACCCTATGGTATAGTGCAGGAAGG
ATACACTGAGGGGCCTGGGCCATATGAGGGCCTGCCCTTCTCATGCTGCATCACGGGATT
TAACCTGTGTTTGATGGCAGCTCTCAGGCTGAGACTATGGTCTTTCCAGGAAAAACAGCN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTAGGTCTTTG
CACTGTGGGACTCAGTGCAGTTGTATGTCCTGGGGTGTGCAGGCCCCTATGGACCTGCTC
ACTGAACCGAAATCCTGGGGATCACATACTAGATTCCTTGAGGAGGAGAGCATAGGACGC
CAGTGCTCAGGGTACAAGTGGTGCTTGTATCTGTGGGTGGCCAGTGGTTGAAACAACAGT
GTAGGAAGGGAAGAAACAGGGAACCTTATTGTGGCTGGATTTCATCCTATGCTGTAGTGC
AGACAGGATCCTCTGGGGGAGCGTGGTCATAAAAGGAGTTGCCCAACCAAAGCCCAAATC
ATAAGACTTCAGTGTGTGTTGGATTTCAGGCTCTTGGGCTTGAGGGGAAAGTGTTGTTGG
GCAAAATGGCATACCATTGTTGAGTGAACACTCATGGATATGCATTTTCCACATCTTTAT
CAGCTCCAGCACAAGGAGCTCTCTGGAGTTTCAGAGAACCTTGGGGATGGCGCTTTCTGT
GGGGACTTTACAGCCATAGTGTGCTCTGTTGTCTACATTCCCTGACCACTGTTGGAGAGC
CCCCATGAGTGGCTCTTGCCATTATCCTTTGCCCTCCATGGCACTAGGAGCCTGACCTCC
CCATGCTTCCAAACTTGCAAATACATGGCATAGATTGCCAGTGTGCCTTGTGGTCAAGTT
TCAACATTACTTTGTCCTGCATGCACCCTTTTTGATCATCTCACTGCCGGGATTGTGGAG
ATCTTCTTTGTTACTTTGGCCCTACATTTCCCATGTTGACTGCCAAGTATATCATCTTGG
GCCAGCCTGTGCTTGCCCTGGCACAGGAGAAATTTCAAGGTGGTCATGTTGAGCAGATCC
GCGTCCCAACCAAAGTGATTACAGTCTTGTACGTGGTATATAAAGGCCTTGGAGGCCAAG
CCTACTGGGCCCTACTGCTAAGCAATGTGAGTTGGTTCACTGGTTCTGGGTTAGAGTGGC
TTGTACCTGTGGCATTGGCAATCATAGTGTCATGGTTTATCGGCTGGCACATGGTTAGGT
TCCATATTTGCCAAAGACCAAGTTACTGGGGGTTACTGTGTGCCAGCCCAGCGTGGGGCC
TCAGTGACAGCAATTAATCTTGGTCAGGAAGCAGTCATTTGGGCACAAAGAGGATGAGTC
TTTTTAGCCCTAGCCCAGGGTGACCAAAACCTATCTCCAGGCTTGGCTCCTGTCCTTTCC
ATGTGTGTGGCCTGATGTTTGAAGGCAGTGTACTTGATGGGGTAGCAGGACCAGGGGGAA
GACCTCCTGACTGCATCACTGGCCCTTTGAGAAACAGCATTTCCACACATGCCTTGCATG
CTGTCAAGGGAGGCAACTACTGTTCCATGGGGAGCCCTTGGGCTTTGTCATCACCCAGAA
GGGTGTCAAATGTGTCCTGCTGAAGGAAGGTTCTGAGCCTTGGCAATGGGGGCTTAAGGG
GTGAGAATGAGAGGTGCCCAGGATGGCAGCCCTGGGAGGTCAGATGCCAGCCCAGGTGGC
CAGGGGCCTTACCCTCACAACACAAAGGGGTACACCCACAGGCTTTCCCAAGCAGAAATC
CTGGAAAAATACCCAGAGTCCCACCCAAAGAATCCTTGTGTGCCAGTGGTCCCCTCTTCA
CATGTACAGTCTGTGACTGTTAACCATGTAGGGCAGACATAGGGCATGTGAGAGGGAGCA
TGGTGCCGTGGCTAGTACGGACAGTGGTGGTGACTTGTGTAGCAGGTTCATCATCTCATG
TTCATCCCTGGTCTGTGTGCAGGTTCTCAGGGGGATTTGTAGCCTACAGTGTGGATCCAG
CGAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACGACTAAGGTCCAGCATGT
TGTCCCCAGCTAGAGATGTTAGGGGTATGGGTCCACGTCCCCTGCCTCATGTTCCATCCA
GCAGTCAGAATATCAATAAAAGCAAATCCTGCCACCACATAGGCAAATGGAACTGTCCTC
CAAGGACTCTGCCCAGGCAGGGGAGTGCTCCATGGGATGGTGATATATGTGGATGTGATG
TCCTTATAAGGAGCCATAGGTCTTGGCATTGTAGTAGAGGGTGCAAGTGGGTGTCCTTCA
GTGTGCAGGCCATGTGCTTTGCAATGGTTGGCCCCTGTGGATCTGATCACTGAACCTGTG
CCCAATGTGGCCTGAGGCCCAGATCCTTGGGACTGTGTCCTTATTTCCCTGAGGAGGAAA
TTTTAGAATGCCAGTGACCAGACTTGAGGTGGTGCTTGTATCTTTGGGCTGCCAATATTT
GTGAGCCAACAGGAAACGGGGCTTTTTGTGGCCAGATTCCACCCTATGCTGTAATGCAGA
TAGAATATGCTGAGGGACATGGCCATACAAGGACCTGCCCTTATCATGGAATAGCAACAT
GTGTTGATTTGGGAGTCCTCAGACTCGGAGGTAAAATCTTGCCAGGAAACGTGGATGAGT
GGTTACTCATGGTACTCATAGATGTGCATTTTCTGCATCTTTTACAGCTCTAACACAAGG
AGCTCTCTGGAGTTTCAGGGAACCTTTGAATGGCACTTTCTATGAGGCTTTAAGGTCAGA
ATGTGCTCTACTGCCCATGTGCCCATGACCTGTGCACCAGAATCTGTCTCACATGTGCCC
CTGGTCTGTGTGCATTTCTCAGGGGGAGTCGAGGCTGGCAATATATCTTCTGGGATGAAG
TAAGATGTACGCTTCTCTTGAGGACCAGAGGCACTGGAGGGCGCTGGAATCCCTGTGGCC
TGTGGTGGGCTCTATTTCTTGGATTTCTGAGGATGGTAAGCATTCCCATGCCATAGGCCC
TGCAGCACCCCAAGCATTCTCAAGAACTGAAAGACCTATATGCTGGCCCTCCACTGATGG
CCTGCTGGCCTGCACTGCTCTGGCAGATTGCCTTGCCTTCTTTCTCTGAGCCATGGACCT
GGTCTCCCCAGGCCCATGAAGGTCTTTGTGGTCGCCAGGCTCTTCCCTAGCCCTGCCACA
GTGCTCCCTCCCAGCATGTGGGCATGTGCTTGGATCGATGATGACTCCCACAAAATACAT
TCCTAGAAGCTGAACAAAATGAGTGAGAACCTCATACCGTCGTTCTCATCGTGACTGAAG
TCCAGCACGTGCCCCCAGCCAGGGTCCTACGAGGAGTGGGCCCACATCCCCAGCTTCTCG
TTCCCTCTAGCAGTCAGGTTATCAAGATAGGCAAATCCTGCCACCACACAGGCAAACGGA
GCCAGTCCTCCGAGGCAGTGCCCAGGCCGGGGAGTGCTTGGTGAGACAGTCATATATGAG
CATGTGTGGCATCCTTGCAAGGAGCTATAGGTCTTGGCATTGTGGGAGAGAGTGCAGGTG
GATGTCCTGCGGTGTGCAGGTAGTGGGCTTGACAATGGATGACCTCTGTGGAGCTGTTCA
TCAAGCCTTTGCCCCATGCCGCCTGATACCAGGATCCCTAGGACTTTGTCCTTGATTCCC
TAAGGAGGAGAGCAAAGAATGCAAGTGCCCAGACTTGAGGTGGTGCTTGTATCTGTCTTT
TGCCAATGGTTCTGAGACAGCAGTGTAGGGCAAGTGGAAACAGGGGCCTTGGTGTGGCCA
GATTCCACTCTACGCTGTAGTGTAGGCAGGATGCACTGAGGTGTGTGGCCATGCAAGGGC
CTGCCCTTCCACATCCCACATCACAGTTTTGTAACCTGTTTTGGATTTGGGGCCCCTCAA
GCTCAGAGGGAAAATCTTGCCAGGAAAAATGGCATACCATGGTTTTTGGACACTCATGAG
TATGTGTTTTCCACATCTTTTCCAGCTCCAGCATAAGCAGCTATGTTGTAGTTCAGGCAG
CATACACTGAGGGTCCTGGCCATACAAAAGGCCTGCCCCTCCTGTTCCCATGACATGGGA
CTGCAGCATTTGTTGGATTTGTGGTTCCTCTGGCTGAGAGGGAAATAGTTGCTGGGTAAA
TGGCATGCCATTGTTGAGTGTGCACTCTTGATTTTGATTTTGCCTGTCTTCTCCAACTCT
GGCCTACGGAGTTCCCTGGAATTTTGGGGAACCTTGCAGATTGCACTTCCACCCTGCCAG
TAAGGGTAGAGTGTGCCAAACTGCCCGTGTTCCCTGACCACTGCTGAGAACCCCCTTAAC
TGGCTCTTTCTGTGTTTCTAGAAGCCCATCATCCCTGTGCTTCCAAACTTGGAAACATGT
GACCTGGGTAGCCATTGTATTTTGTGGCCAGGCTTCCTAACCTCTTTGTCCTGCATGGGC
CCTCTTTTGGTCATCCCCCTGCCTGGGTTGTTGAGATCTTCCAGCTGAATTTGGCCCTAG
GTGACTGCCAAGGTTTACCATCTTGTGATAGCATGCACTTGCCCCAGCACAGGAGAAAAC
TCATTGTGGTCTTCATTTGTTTGTTAGAGTTCTGTACTTGTTTTATAAGGGCCTTGGGAG
CCAGGACTCAGGTAGTCCCCTAGGCTTTATTGCTTGGCTTGTGGGAGTTGACTCACTGGT
GCCTGGCTGGAATGGCACATGGGCAGGACAAAGGCAAGTGCAATGGAGTGGTGTGCTGGC
CGTCACCAGGTGGACAAGACCTGACACTAGCGTGTTCCATAGTTGCTACATACCTTCTTC
CTTCAGGGGTTCTTGTGTGCCAGGCTGGCATGGGGTTATGGGGATGGAAGGAAAGCTCAG
TCAGGAAGCAGTCATTTGGGCACTAGGGGGTGGAGTCTTTGTGGCCCTCTTCCAGGGTTT
CTGAATCCTGCCTCCATGTTTGGCCCATGTCCCTTCCATGTGTGTGGCCTGATGGTTGAA
GGCAGTGTGCTTTCCTGGGTAGCAGGAATAGAGGGCAGACCACCTGACTGTGTCTTTTTC
CCTGTGAGGGAGGACATGTCTGCACGTTCCTTTCATGCTGTTACAGGAGGCAGTGGCTGT
TTGACTGGGGGTCTGTGGCCTCTGTCATCACCCAAAAGGGTGTGCGTGTGTCTTTCTGAT
GGAAAGTCCTGACCCTAGGCAGTGGAAGTTCAAAGGCTGAGAAAGAGAGGTACCTGAGAT
AACAGCCCTGGGAGGTCAGATGCCAGCCCAGATAGCCAGAGGCCTTACCCTCATGACACA
AAGGGGTTAACCCACTTACCTTTTGAAGTAGAAAGCCATATGGCAAACCACATGGAGTCT
CACCTGTATAAGTCATATGTGCCAGTGGTCTCCTCTTCACACATGTGATCCACAATGGGG
AATCAGACTGGGATGCAGATGTAGGGCATGTGAAAGGGAGCATTGCACCATGGCTGGATA
TGGACTCAGGCTTTGAGCTGTGTAGCAGGTTCATTGTCACATGTGTGCCCCTGATCTGTG
TGCACTTCTCAGGGGAGTTGCGGCTGGCAACATGGCTTCTGCGGAGGCACAAACTGTACA
CTTTTCCTGAAGAACAGAGGCACTTGGGGGCCCTGGAATTCCTGTGTCCTGCAGTGGACT
CCATGTCGCTGGAACTCTGAGGATGGTAAGCATTCCCAGGCTCAGAGGCCCTGCAGCACC
CCAAGCATTCTCAAGAACTGAAAGACCTATGTGCTGGCTGGCCATTGATAGCCTGCTGGG
CTGCACTGCTATGGTGGATTACCTAGACTTCTTTCTCTAAGCTGTGGACCTGGACTCTCC
AGGCCACTGAAGGTCTTTGATGTCACCAGCTCTCCCCTTGCCTGGCCACAGTGCTTCCCT
CCTAGCACATGGGCATGTGCTTGGATCAATGGTGACTCCTGCAAATACCTCCCTTGGAAG
CTGAACAAAATGAATGAAAACCCCATACCGTCATTCTCATCATGACTGAGGTCTGGCTTG
TTTCCCTTAGCAGGGACCTTAGAGATGTGGGCTCACATCCCCTGCCTCAAATTTCCTCCA
TCATTAAAGGTATCAACAAAGACAAATTTTGCCACCATACAGGCTAATGGAACCTGTTCT
CCATGGGCTATGCCCCAACAGGGGAATGTTTGGTGAAATAGCAATGTTTGTGGGTGTGGT
GTCCTTGCAAGAGAGCATGGGTTTGGTGTTGTAGGAGAGGATGCAGGTGGGTGTCTAGGT
TGTGCAGTCCATGGACCTGGCAATGGGAGGCCCCTGTGGACCTCCTGACAGACCTTGCAC
CCTGTGTGGCCACATCTTGGAATCCTTGAAGAAAGCTTAGGACACCAGTGCCCAGACTTG
AGGTGGTGCTTGTATCACCAGTCAGGAGAGCATCAAAGGCAAATCTGGCCACCACACATG
CATACAGAACCTATCCTCCATGGGCTTTGTCCATGGGATGGTAATGTGTGTGGGAGTGTT
CACTTGCAAGTGGGCTTAGGTGTTAGCTTGGTGAGAGAGGGTGCGAGGGTGCAAGTGTTT
GTCCTGGGGTATACACGCTGTTTACCTGGCAATAGGTGGCCCCTACAGACCTGCTGACCA
AACCTGAGCCCTGTGTGGCCTGAGGTCAAGAGCCCTGGAAGCATGGGTCATGGAATTGCA
GCATGTGTTGGTTTTTGTGGTTCTTATGCTCAGAGGGAAAAAGTTGCAGGGCAAAATTGG
GTACTGTGGTTTAGTAGATACAGGTGTACGTTTCCCTTGTCTTCTCCAGTTCCAGCAACC
AGAGCTCCCTGGAATAGTGGGGAACCTGTGGATGGCACTTCCTGTGGGACTTTAAGGTCA
GAACATGCTCTACTGCCCGTGTGCCCTGACCATTGTTGGTGAGCCCTCATGACTGGCTCT
TGCCATGGTCTTCGATCTCCTTGGTGCTTGGAGCCTGACCTCTCCATGCTTCCAAGCTTG
CAAATATGTGGCATAGGTAGCCAGTGTGTGTCAAAGCCAGGCTTCTTTACTGCTTTGTCC
TGCAGACGCCCTCTTTTGGTCATCCCACTGCCTGGGTCATTGAGATCTTCCTGCTCACTT
TGGCCCAAGTGCCCCTAGGTGACTGCCAAGGTGACCATCTCTGGACAACGTATGCTTGTC
CCAGTGTAGGTGAAAACTTACAGTGGTTGTCATCAGCAGAACTGTGTCCCACACAAGGCG
ATTGAACTCCTTTACTTGATTTGTAAGGACCTGGGGGGCCATATCTGCGGTGGCCTCTTG
GCCTTGCTGCTGGGTGTCTGCAAGTTGGCTCACTATTGTCAGGCCAGAGTGGTGTGTGTG
CATGAAGAAGGCAAATGCAATGGCTTGCTGTGTGTCACCTGGCACACAGTTAGGTAGACA
AAGCCTGATACTGAGTACCATAGTTGCCAAGCATTGTGTTCCTTCAGGGGTTCTTCTGTG
CCAGGCTGGCATGGGGCCTTGGGGATGGAAGGAAAGCTCAATCGGGAAGTAGTCATTTGG
GAACTGGGGGGTGGAGCCTTTGTGGCTCTCTTCCAGAGTTTCTGAATTCTGCCTCCATGT
TTGGCCCATGTCTCTTCCATGTGTGTGGCCTGATGGTCAAAGGCAGTGCTCTTGATGGGC
TAGTGGGACTAGAGGTCAAACCTCCTGACTATGTCATTGTCTCTGTGAAGAAGGGCTTGT
CCACACATGCCTTGCATGCTGTCACTTGAAGCAGTTGCTGTTCTACTTGGAGTCTGTTGC
CTCTGTTATCACATGAAAGAGTTTTCTGTGTGCATCCTGCTGATAGAAGAGCTTGACCCT
TGGCAGCAGATGTTCAAGTTGTCAAAATTGGAAGTTTCTAGGAAGCAAGCCCTTGGATGT
CCAGATGATTGGGCAGGTGACCATAGGTGTGACCCAACCAGAATCTCCTCTTGAAAACCT
CACACATATGCAGTCATAGGGTGCCAGTGTTTGATCCTCCCATTCAAAGGAATAGACCCA
TACACCTTCTCAAGCAGATACTGAGTTGGACAACCACTTACAGGTTTTTTTAAATTTATT
TAACAGATAGAGTTAGACAGTGAGAGAGAGAGAGAGAAAGGTCTTCCTTCTGTTGGTTCA
CCCACCAAATGGCTGCCACAGCCGGTGCTACACCGATCTGAAGCCAGGAGCCAGGTGCTT
CCTCCTGGTCTCCCATGCGGATGCAGGGGTCCAAGTACTTGGGCCATCCTCTACTGCCCT
CCCGGGCCACAGCAGAGAGCTGGTCTGGAAGAGGAGCAACCGGGACTAGAACCCGGCACC
CATATGGGATGCCGGTGCTGCCGGCAGAGGATCAACCAAGTGAGCCACAGCGCTGGCCCC
ACCTAGAGTTTTATGTATTGAAATTTTGTGTTCTAGTAGTCTTCCCTCACAAACACAATT
TCCATTTGCAAATGATGTCAGGGATGTAGACTTCAGGCACGAGAATTGGAGGATGATACC
ATATCTTGCAATGGCATGTGGGCTTAGCTTGTATACCTTGTTCATTTTCTTAAACTTGCC
TCTGATCTGTGTGCTTTTCTCAGATGGCATTGTGGACAGTGGCTTAGTTCTGCAGATACA
CAAGATGTATGCTTCTCCTGAAGATCAGAGGCATTCTGAGGTGCTGGAATACTTGTTGCC
TGCAGCAGACCAGAAGTCGCTGGAGCTTGATGACAGTAAGCATGCCCCAGACCAGCAGCC
CTACACTGCCCAAAGAATTTTGAAGACCTACAAAGACCTGTGTGTGTGCCGGCCTCTAAT
GCTAGAGTAGATTGCCTAGCTTTTCTCTGGGCCATGGCCCTGGATTCTCCTAGCTTGAAG
GTCTTTGATGTCACCAACCTGTGGTGCTCCCCTCCCAGCACGTGGGTATGTGTTTGGGTT
GATGATGACTCCTGCAAATACAATCCTTGGAAGCCGAACAAAATGAGTGAAAACCCCATA
CAGTCATTCTCATCGTGACTGAGGTCCAGCAAGTGTCCTCCAGCATTAACTGGAGGGTTT
AGTTCTCACGTTCTCCACTGTATGTTTCCTTCACCAGCCACAGTTCCTCATGTCTATATG
TGTGATTTTTCTCTGTGCATTCCATTAACTGAGGTTTATAATGTTTTCTGGAATGATATT
CTATTAAAATCCCATGCAGAATGCTACCTTGATTTTTCAAGGAAACCAAAGTTATTCTCT
TTTTGCCTGTGTGGTTAGGTTTTAGTTGTGGAACCCTGTTTTTTTTTTTCACCCTTTTTG
GCTTGACTACATGAAATGTTCCCCCTTGTGATTCTTTGGTATATGTTGTCAAGATTTTTG
TTCTCATTCCATCATACTTTAAGAAGTTTCCAACCATGTTCCTCTAAAGTTCTGATTGCT
GTTCTTTTTGTTGAAATCTGGTATCCCTTATTCCTCTATTCCAATCTTCTTCCTACATGC
ACTTTTCCCTAAGAAGAGGTACATTCCATTGCCTAATTAATTCATTTAGTCTTCAGTGAC
ATTTGATTTCTCTCATGGGGGTATTACGTTTTCTGTGTTTCCTTGTTGTCATCTGGTGAT
GGAACAGTTAGATCTCCCATCTCCATAAATATTAACTTTCCTTTTTCATGGAGTTATTTA
ATTTTTATCTTTCTTTTCCTTGTGTTGAAATATTTTCTTTTCTTTTGGTGTGGCATTTAG
TCTTGATGTACCAAGGAGGAGATAAAACATATGTTGTTATTAAATTGTCTTAAGATAAGT
CACAGTATGTTGTGGTTGTGATCATTGAAGCCATCTTATACCTTGTATGCATGTCATGAT
GCAGATGTTCTGGGTTGGCCTGCATCCAGTAGTAGTGTTTTCTGTTTTGTGTGATTGGCC
TTTTGTGTGATTGACCCTTTCTTCTGATTCTTTGCAGGAAATTTTTTGGATTTGAGAAAA
TTACAGTTGGTAGTGTACTTCTCTGTTACCAATGGGTATTAGGTTGATCAGTCCATTTTT
GAAAGCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved