Oryctolagus_cuniculus Locus Mono:131:SNORA66
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:131:SNORA66
Oryctolagus_cuniculus
Mono:131:SNORA66
scaffold_145984
SNORA66
1001..1133
2133
GCGTACATGGTTGGAAATCACACCAAGGGCTTCTGCTTGCTGTCGGAGTGCCAAGAGCA
GAGAGAGGCAGGCCTGGGCAGTGGTCAAGGCTCCAGGCCCAAGGCCACCTGGGGCCCAGG
CCGGCTTTTCCACCTGGAGACCACAGCACCGTAAGGAGCATCGTTTCCCATACCCAAGGA
TGGAATCTACGGCGCAGGCTTGTGGTGAGAATTAAGAGCATGGATGTCCACAGTGGTTCG
GCAGGGAACAGGCAGGCAGCAGCTGTTAGCCAGTCAAGCCCTTGTGTCTTGTTTGAATTT
GAGTAACATCCTGTGAGGCAGGAAGAGACTGCTGGTGTGGTTTACCCTGCTATCCTGGCA
CTTAGATAATTAGACCCCCTGTGTCTCTGAAGCCAAGCCCAGGGTTTGCTCTATTCCATC
AGTGTTTCCTAAACTCTGTTCCAACTTTCAGTTGCTCACCAAAATGCTGATAAGCGTTCC
TCCAAATCAGGGCTGAGTGAGCACCGAGTGGTGAGTGAAGTTAGCGTTAGCGTAGGGTTA
GGTTAAGCTATTGCCCACAGGGTTTGTCAGAGCCCTTGAAGAGCCAAGCACACCTGTGAC
TAAGAGCGGGCACCTCTCCCACATCCTGGGCCATCCCACGGTTTTTTCCATGCAAGACTT
TTCACACCCAGGGGAACATTAGGGCTATGTGCAAAGTGGCTCTGGGACTGTTACAGGATG
TTACGGGGCAAACCCGATTAGGAGAAGGTGGAACTATCCAACATCTGTTTTCATGCCAGT
TTCCACCAAAGAGAATTGGAGTGTAAAACACACTGGGGCGTGGTGGTGAGGGTGGAGGTG
ACGGATCTTGGGAAGAATCTGAGGAAAAGACTGAGATCTGAGTTCAAATCCGTCCCCACC
CCCCAGCAATGGCAAGGCCTTTGTTTTCTCAGAATCTCCATCGCTCCCTTTATTAGGCAC
AGAGTAAGCATCCACTTCACTTGGTTGATTTCAGATGAAATGTGCAGACCCCATCACTGG
CTCTGTGTGATGTGGCAGAAGCGAAGGGAGACAGGTTTGCTAAAGTAATTGTGGTGATAG
AAATGTCTGAGCCTCAGAGGCTGCTGAGGGAGCCCATTCTATCCCAGGACGGAGGAAAAA
AAAAAAAAAAAGAAGTTAAATGTCTGTGTCTCTGAACTGCTTGCCGCTCGAGGATTTCTC
ACGCTTAGTTTTCTATCTGTGATACTTAGAAGGCTCACCATTGCAAACAGCAGGCAGCCA
AGTCTAAACTGGATAAAAAAGATATATATGTAGAGGCCGGCGCTGCGGCTCACTAGGCTA
ATCCTCCGCCTTGCGGCGCCGGCACACCGGGTTCTAGTCCCGGTCGGGGCGCCGGATTCT
GTCCTGGTTGCCCCTCTTCCAGGCCAGCTCTCTAATGTGGCCTGGGAGTGCAGTGGAGAA
TGGCCCAAGTCCTTGGGCCCTGCACCCCATGGGAGACCAGGAGAAGCACCTGGCTCCTGC
CATCGGATCAGCGCGGTGTGCCGGCCGCAGCGCGCCGGCCGCGGCGGCCATTGGAGGGTG
AACCAACGGCAAAGGAAGACCTTTCTCTCTGTCTCTCTCTCTCACTGTCCACTCTGCCTG
TCAAAAAAAAAAAAAAAAAAAGATATATATGTAGGGAATTTGCCAAAGTTAATAAAAGTC
AGATGGGGTTTTACCCATTTGTGACGTCACTGGAGCGGGTGGGGATCTCACCCCCAGGAA
GCTCAGTGCCCAACCCTGGAAAAACCCACGACTCATCACTGATTAGACGACCTACACGGC
CCTAATCTCTAGGGACCCATACAAACTCACCAACAAGTGGCCTGCAGCTGCTCTTGTCCC
CTTTCTCCAGAGGGGACCATCTGGGATGGGTGACTCTCCAACTCATCAGCTGGGCACCCC
TAGCAGCTACCAGGATTTCTGGAAGGAGTTTACAAAAGCATAGTCCAAATCCTGCGATTT
TAATAGAAAACAAAACTCACCAAATCTCTTGACTGATAGAGATATTTTTAAAACTGTAAA
AAATAATCATTATGGGGCCGGCTCTGTGGCACAGCAGATAAAGCTGCCAACTGCAGTGCC
GACATCCCATATGGGCGCCATTCAAGACCTTGCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved