Oryctolagus_cuniculus Locus Mono:41:SNORD15
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:41:SNORD15
Oryctolagus_cuniculus
Mono:41:SNORD15
scaffold_209224
SNORD15
1001..1146
2146
GAGCATCATTCTTCAAAGAATTCGTGATAGAAGCTATACATGGCATCGGTCCTGGGGTA
AGCAGACACCACGCAGCTGCCGGGCCTACTGAGCTGGGTGAGTGTTCTAGCTGTGAACCC
TCAGACCAAAGAGGGTGGCAGTGGAGGAAGCACCCAGCTGCAGAAAGGGGCTAGAGAGAA
GAAGAGACCCAGGCCAACATGCAAACGGTCAAATCTACTCATTAAACAGGCAGATTGGGA
AGCAGGGGAGGCTGGCTTGTTAGGAGCATGTGATACAGAGTCCTTATTCGCCTGCTCCAG
AGAAAATTGATGCTGAGCAGCCAGAGTCTAAATCCATTGACCTTGTGGCTCAGACCAAGT
TGAAGAGCGGGGCTGGATGTGCCTACAAATTAGCAGAGCCGAAAACAAGTTTCATCTTCT
TTCTCTGCAAGCAGCCAGCTTGGCTCAGCTACAGCAGGATGGCTCTGGGTAGCTGTCGCA
CACAAAAGTACTATTTGTCAAATGCTCCACAGAGGCCAGGGAGCCAGAATTCCAACTTTG
TTCCGTACTTTTAGGGACCTGCCCTGAGCAGATAACTGCAAATTCAGCAGCTATCCATTT
GGGCTGTGTGTGCCAGAGACACCTCAAAAAGGCACATCTTGTAAGGCCCATGGGTTTTAT
CTAGCATCAGCCCGGCCTTTCCAGGTAAATTAGCAAGGAATTCCCATGCCTGTTGGAGGG
ACCCCAAAGGCTGGGACTCACACTCCAGTATCTTTCTCCGGTGATGCCAAGGTTGCCTAG
CAAGATCTTCATCTCCATTCTAATGTATCTGACTCCACTCTCCCTTCCCCTCCCACCCAG
CCTCTGCAGAAACAAACCAGCCAACCCTTACTTTCCACTTGGGCCTTCCAAATCCCCTTA
ACCAGCATGAAAGACAATGCTATCACCACAAACTGGAAGCCAGCATCTCCCTGCCTCAGC
TCACCACCACCATTCATGCCAGAAAGAAAATAGGTGGTTTTCTTTGGTGATGACATAATG
ACGAGTCAGAAAGGTTACGTCCTGCCCTTGGGCCGTGTCAGTGCCACGTCCTGTGGTGCT
GTGCGTGGGTTCCTTTGGCAAAAATATCCTGTTCATTGCCTGATTTAGAGGCATTTGTCT
GAGAAGGGACCACATCAGAGGTTCTTGGGTCAACCCTTCCTGCTGTGTGGTAGGGGCTAG
TGTACCCTAGCTAGGTCCTAACTCTGTTTCCTAGGTGTGCTGGGGATCAAGGTGAAGATC
ATGCTGCCCTGGGACCCAAGTGGTAAGACTGGCCCCAAGAAGCCCCTGCCCTATCACATG
AGCATTGTGGAACCCAAAGATGAGATTCTGCCCACCACCCCCATCTCGGAGCAGAAGGGT
GGGAAGCCAGAGCCGCCTGCCATGCCCCAGCCAGTCCCCACAGCATACCAGGGTCTCCTT
GGCAGCTGTAAGGAATCTGGATGTTACTTTATAAAGATCTTTAATTAAATCTTGTACAAA
GAAAAAAAAGAAAATGGGTGGTTTTAAAAGAGAATCAGGAGAGGCCAGCACCGTGGCTCA
ATAGGCTAATCCTCCACCTTGCAGTGCCGGCACACCGGGTTCTAGTCCCAGCTGGGGAGC
CAGATTCTGTCCCGGTCACCCCTCTTCCAGGCCAGCCCTCTGCTGTGGCCCGGGAAGGCA
GTGGAGGATGGCCCAAGTGCTTGGGCCCTGCACCCCATGGGAGACCAGGAGAAGAACCTG
GCTCCTGGCTTTGGATCAGCGCGGTGCGCTGGCCACAGCGCGGCGGCCATTGGGGGGTGA
ACCAACGGCAAAAGGAAGACCTTTTTCTCTGTCTCTCTCACTGTCCACTCTGCCTGTCAA
AAAAAGAGAGAGAGAGAGAGAATCAGGAGAGAAAGCAGTGACAAGGATGAAGGGGTAAAG
GCAGGAAAACGGGAAGAGAGAAAGGAGGAGGAGGAACTGTGGAGACAGAATAAAGGATGG
GGAGGGCAGCTGGCAAAGGGAAAATCGAGAATCGAACCACTGTTCGCTCACCTCAGCCCT
CCTGAGAACCAGAACATGGTCACTAATAAAGGGCAGAGACACCATCGGCTCTAGGGAGAG
TCAGGACTACAGGGTTCCAGCCTCTGAGCCTCCAGGATGAACAAAGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved