Oryctolagus_cuniculus Locus Mono:60:SNORA28
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:60:SNORA28
Oryctolagus_cuniculus
Mono:60:SNORA28
scaffold_94410
SNORA28
1001..1122
2122
CCGGTTCTACTCCCGGCTGTTCTTCCAGTCCAGCTCTCCGCTATGGCGTGGGAAAGCAG
TGGACGATGGCCCAAGTGCTTGGGCCCCTGCACCCACGTGGGAGAACCGGAAGAAGCTCC
TGGCTCCTGGCTTCAGATCGGCTCAGCTCTGACTGTTGAGGCCATTTGAGGAGTGAAATG
TCAAGTTCCAACCAGCGGATGGAAGACCTCTCCCTCTCTCTCTCTCTTTCTATCTGTCTG
TAACTCTACCTCTCAAATAAATAAATAAAATAATTAAAAACATTTTTAAAAATCATCTCC
TTCTTTTCTGACCTTTATGTTCTTCCGCACTTTCTAGGATCTCCAGCACAATGTGAATAG
AAGTGATGAGGGTGCACAACCATGCATTGTTCTTTAACTTAGGAGAAAAATGTTCAGTAT
TTCACTATTAAATGATGTAATCTGCAGACTTTTTTGTGAAATAGTTTCCCTTTATCCTTA
ATTTGTTGAAATTTTAAAATAAAAAACATGTTAAATTTTGTCAAATATGTCTTCTACATC
TATATGATTATACTTTTCCCTTTTGTTCTATTGTTATATGAACTTCAAAAATATTAACCT
AATGTTTCATTACTAGGATAAATCTCGCTTGATCATGATGTAAGTGCTCTATTTATGTAA
ATGTTTATATTTATATATATATCGCTGAATTTGATTTGCTAATAAAAGGCCACTTCAAAA
AGTTTATGGAAAAAACAAATAAAAGATAAGTTAACTTTGTTGAAGAGTTCCGTGTATTGT
TCTACAATTCACATCTCCACGGTCTTTTTGAGGATTTCTTATATGCATATATTTCAATAA
TTTTTTGCATTGAAATAACATCTTCAATTTCATTTTCCAAGTGGTATCACTGGCTCCTAT
GGTAGGTGTATATAACTTTATAAGGAACTGTCAAATTGCCTCAAAAAAGTGAGCTACCAT
TTTTGCATTCTCTCAAAGCCAAAAAAAATGGAAATGACTGCAAGCAGTTCTCTGTAGCAG
ACTATTAAAACTGTCACAGTTTGGGCTTGTTATAGCAAGGAAGTCTAACCTAGTCTGGTA
TTGTCTCCTCTGTGAGACAAGCCATTATACAGATCTAAACAGTGTAAAAACAACAACAAC
AACAACAAAAAACAACCAGAAATGAATCTCCAATAAAGGGACTTTTATTCAGGAATAAGG
AATAAGATTGCAATCTAGGATACACCTGCACAGGTTTGGTGGTGGTGGTGGGGGAGGCTC
TGGAATGTCTGAGAACAAAAGAAAGGTTGGGGTGTATTAGAACAGAGAATTCTACCTGCA
TTATTCTGAAGGAAAGTTCATAGACACTTTCCACGCTTGAGGGAGCTGGGCAAGCTGTTC
CTTCCCAGTAGTGGTAGCTCCCATGTAAACCGAGCTGTATAGTCACGGTTGGCAGGACAG
ACCATTTTACTGCTAAGTAAAAGCAGTCTTATAGAGAGGGCAATCTGTTTCATTGGATTG
GTTCTGCAAGATCATTCCTGGAACAGGCTTGACGATCGGAAGTTTCCACTTCTTTACCAC
TCCATTTTGTTTGATGAATTTTCACACATTCTCTACAGTAATGTAAAAGAATTCTATTTG
TTTCACATCTAGTATTGCCAGCTTTTGAAAATTTTTGTTTTAGGCATTGTAGTTTTAAAT
TGCATGTTTCTTTTGCTTTTTAAATTTATTTATTTGAAAGGTAGTTAGACAGAGGCAGAG
AGAGAGGGAGCTTCCCTCTGCTGGTTCACTCCCCAAATGGCTGCATCAGCTGCATCAGGT
CTGAATGCAGCAGTCAGGAACTATTCCGGGTCTCCCATGTTGGTGCAGAGGCCCAAGCAC
TAAATCAATCTTCCACTGTTTTCCCATGCACATTAGCAGGAATCTGGATCAGAACTGGAG
CAGCCGGGACTTGAACTGGGGCCCATATGGGATGCGAGTGCTGCAGGTGGCAGCTTTACC
TGCTGCTCCACAGCCCTGGCCCCCAATTTTCATTTTTGTAGTGACTATGTTGAGTACCTC
TTTATATGCTTATTTGCCATCCATATATCTTCCCTGCTGAAATGACTGGGTATTTTGCTC
ATTTTTAAAATGGGTTGTTTTCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved