Oryctolagus_cuniculus Locus Mono:218:SNORA31
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:218:SNORA31
Oryctolagus_cuniculus
Mono:218:SNORA31
GeneScaffold_1638
SNORA31
1001..1128
2128
CATAGCATCTAGTGATATGATCTGCACACAGGAGACACTCATTTCATGAATGTAACGCC
CTTGCAAAGACATTAAGACAGGTATGTCCTACTCAGAAAGAAGCAAGCTAAAGAAAAGAC
CACCTTGAACAATTTCTTCATCATTCATTCTTCAACTGTCCCTCGCTCCCTACCCCCAAC
ACACCATGGGGACCACCTAGGAAGAGGAGAGATGCATCCAAGTACAAAAACTTGTCACAG
GCAAACCAAACTGAGGAAAGACCCTAACTGTACACCACTCCATTTCTGTTTATTGCCTCT
GCAGGAGGGCAAAAAAACTTTTTTAAAAACCACACATAACCTCATTTCTAGACAGAGAAA
AGGAAAGCTCAGGAAACACTACCCAGGGGCTCAATACCCCAAACCTGTCTGGGTACACGT
GCGAGAAGCAGTGGCAATGGAGGAGCAGGTGCAGCACTGGGCCTGCCCTGGGAGGGGCAG
CCACACATGGGCACGTGTGCGGATGACCATTTTTCCTGTCTAGACAAAGGGTACTATAAA
TACTGCTGCTCCCATCACCACTGTTATCAGTCAGACATTCCAGAGGAAGATACAGCACTG
AGAGAAAATATGTTAACGATCTGAGTATGGGCCAGCTCTCTGGAGACCAAAAAAAAAAAA
AAACAAAAAAAACAAAAAAAACCACACCAGCTCCTTGGTATTTTTCCTTAAATTTGCCTG
TGCTTCAATGACTCGGAACAAAGCTCAGGGTCTTCTTTCCTGGTCCCTTGACCTTGGAAC
AGCAAATGTCCCATGTATGAAACACCCCATGGGGCTGCTTTGCCCACGGTCATGACTAAA
GGGCCTGCTCCTGGCAGGATGTGCCGAGGGTGGCACTGACACCAAAAACCCACACAATGC
ACTGGCCCCGAAGGCCCCTCCACTCCTAGGGAAACATGACGGGGGCCTTGCGGCTGGCAA
GGTGGGACCTGCCAGTTACCACCTTGAAGAAGGAGATTTCTCTGCATCCACTGATAGACC
TTGAACAATCTGCTGTTGTTCTTTTGGTTTGCACTAGGATGCCAAAGAAAAATCCCTGCA
CTTTCTGTCTACCTTTGTGGCTGTCCAGATTGAATTGGGGAATACATTTGTAAAGAAAAA
AAAAAAAGAAGAAGAATTCTCTGGACTGGCTGATGAACTCAAGGACAAAAGCAAAACACA
TTTGCCGGCTTTGTCTACACGGCTTCGTTGCAAATGTACTGGACTTGAGTGTGTGAAGCA
CAATGACTGAAAGCAGTACAGAACCTCAGAGACCGGGCCCCACACCCAAGGACCCGACCG
TCTGCACATCCAGAAGAAAACAGAGCTGCTACCTGTTCTTCCGCCCAGATAACTCCCCTT
TGCTGGGGTCAATCACTGCACGGAAGTGGCCTCCACCACGTCTTTAAAGAGGCCGGGAAC
GACTCTCACCTGCAGCACCTGGGGGTAGTGGAAGACCTGGTGTTTGTGGCAGCGCTTCCG
GACAGAGAGGGCGCCCTCCGAGAGGTTGGTGCACTGGTGCAGCACCAACACTGACTCCCC
GTGCTTGGCCTGCAGGGCCTCCAGCTCCTCTCTGAACTCAGGGTGCACGGCCATCTGAGA
CGACAGGAGGAAGTACCGCCGCGGGCTACAAACGAGAAAACAGGCAGCTGGAAAATCGCA
GTTTGTGTGTGAGTCAAAGGAAGACAAACTTTGATATTAGACCCTCAGTAATAAGCGCTT
TCCCACCAGTGGACACCATTGACTTTTTTTGGGAACTGGGGGAGGGACTTAGACTCTGTA
ACATTACCGACTATCTTATTGTGTGCCGCTAACGAACAGAGTAAAGTATAATTCATTTAC
ACGCTGAAATACCTGTGCACCCCATAACACTTTTATTCGGGAAGTTCACTGTTGTGATAA
TTAATATTTATATTATGCCCAAGTTTAGAAAGAAGATGTGTGTGTGTGTGTGTGTGTGTG
TGTGTAGAAAGAAAGTGACTGAATATTTGGAAGGAACATAAAAATATTATTTTAATTATT
TTATTGATTTGAGAGGCAGACAGAGAGAGAGAGACAGGTAGGGATCCCATCCACTGGCTT
ACTCTCAAATGCCCACAAAGGCTGGGGAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved