Oryctolagus_cuniculus Locus Mono:79:SNORA7
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:79:SNORA7
Oryctolagus_cuniculus
Mono:79:SNORA7
scaffold_211770
SNORA7
1001..1128
2128
GCTAAGATTTCAGTAGAGAGAACAGAAGGAGAGTACAGACATAAGATCCTGGAGGTAAC
TGAGGGTTCTGAAATAAAAGAAATGAAGAGTGTTGAGTGAAATTCTGTATTTCTCAATCT
TTCCTGCTCTCCATTCTTTCTTCTTTGCAGAGGCAGAGATAAAGGATGACCTCTATTAAT
TTTTTAATGGAACTTGAAGTAGCAGAAGGAGATATTTCTTACTCAAGTGAGGAAAAGAGC
TACTAGAAACCAAAGGAGCAGACAAGCAATTGTAGTGGGACAGAAAGGACTACAATCCTG
CGGAACGCTTTTCTTCACGGGGTGCTGGAGAGTGCCCTGCTCTCTGCACTCCGCAATTCA
CGGGCAGGATGAGACATGAAATTGCCAGACAGAAAGAGTCACGGCAATGACACGCAAGGC
TAGTGATTGACTCTTCTCTACAAACTGTTCACAATCAGATAAACAACCCTTTTCCTGGAG
AGCACCATGCTTCAGAATTCCAACCTCTTGAGGTAGGAGCTACTTTTCTATTTCCCAAAG
TCCAGAGATAGATTTGTACATGTGAATGGGTGGGGCTGGCAGATGGTTGGCAAAAGATAA
AAGGAAGATTTGGGGCACTCTTCCCACCCCAAGTCTCTATGAGAAAGACTAGAGCAGAGT
ACATTAAAACAGCAACTGCTGGGAAGGCAGTAAAATGACTGTACATATACATAAATATTG
GGGAAACATAAAGACAGATAAATGAAAGAGAAAGTTGGATGGATGGATGGATGGATGGAT
AGATAGAGCAACAATTATTTTCCTGTTTTCATAGGAAGGTTCTAGAAGTAGATAACCATT
GCATTAATGGTACTTATCTCTGACCACTGAGAGTATATGATGGCTTACTTTGTCTTATTT
AGGCTTCTATAGAGCATTTAATTTTACAAGTCTCTGGGATAACCTTCACTTATTGGGAGT
CCCGGCTCTAAATTGCATAGAAAGATTAAATCAAACCATGAGACCTCTTGGATCTCGTCT
GGAGAGTGGCTGGGCTTCTGCCGGCTTCAGAAGTGGGAGCGAAAGCAAGGCTGCAGAGGT
ACCCATTCCAGCTCAGTAGCTGGTGATTAGAAGACCCTGTGCAACAGTGCTCACAAAAAA
AGCAAAAACAAATAAATAAATCAAACATAAAGATGCTCCTCTTGATCCTAACAGAGAAAC
AGTGGGAGGATCAAAAGAAAAATATATCTGGGAACTTTCCTAAATGCTTTTATCATAAAG
TATTAACCTTTTAGGGTATATTTCTATAGAAATGCCTATTTTATTTAACAATTATCCCCT
AAATATTTCCATATTACCTTCCTTTATTATTTTAATCATTTTTCTTAAAATGAGACTATA
AAAATTACAAATGAATTGTTTTACTATAAGGGCAGTACTAGACTACACATTAATGGAATT
TTAAATAAGAAAGACAAAGATTAACACCTAAATTCTACCCATCGCTATCCCTACATGCCT
ACAAAGAAACAGGCTATTTTCTCTCCCAATTTTTATCCTACAGATGATTGCCAACTTGCA
TCTGAAATTAACTGAAATCAACAGTTGTTCTAAGCTGTTAAATTATAAACATTGCATTAA
CAATGCCTTACTGACCTCAAACTCTATAAAATGCATAATTAAATACAATGACCTCCTCCA
GAAACGGCAAGATAAAGAACTGCTCTGTCAGGGCCAGCACTGTGGCACAGCAGCTTAAGC
CTTCATATGTAGGGCCAGCGTTTCATATGGACACTAGTTCAGGTCCCAGCTCTCAACTTC
CAATCCAGTTCCCTGTTAATGTGCCTGGTAAAACAGCAGAGGATGACCCAGGTGATTGAG
AACCTGCATGCATGTGGGCGACCAGGAAGGGGCTCCTGGCTCCTGGCTTCAACCTGGTCT
AGCCCCAGCCGATGTGGTCATTTGGGGAGTGAACCAAAGGATGGAAGATATCTCTCTAGC
TCTCTGTCTGCAATTCTGACCTTCAAATAAGTAAGTAAATAAATATTTTTAAATTGCTGT
GGTAAAATTATTCAGAGATCTGATTCCTCACAAACAGTGTTTATCAGGCATCAGCGGTGT
GGTACAGTGGGTTAAGTCACTGATTACAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved