Oryctolagus_cuniculus Locus Poly:30:SNORD12
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Poly:30:SNORD12
Oryctolagus_cuniculus
Poly:30:SNORD12
GeneScaffold_3669
SNORD12, SNORD12, SNORD12
1001..1091, 2230..2318, 2519..2610
3610
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNCCCCGGCAGCGGCGCCACAGCCCCCCCACCCCGGCGGCGGC
TGTCGCCTCAGCTCCCCCCAGCGGCGGGGCCGGCGGGCTCCGGAGGGCGCGGCTGAGGGG
AGGGGACTGCGGGGGGCGGGCGGACTGGGCCCAAGGCCGTCGCGGGCCTCAGTCGGTCCC
GGCGGACGGGGGACCCGGCGGGCGGCTTGGTGCGCTTGAGGAGCGACATGGCGGTGAAGC
CGAGAAGCCCGGGCGGCCCGCTGTGTCCAGAGAAGGGGGCGGGGCTAGACGCGGCCTTGC
CGACCATTAGAGCGCTGAGCGACCCGGAGACTACATTTCCCAGGGGGCCCCGCGCGGCGC
GTTTCGAGCCGAGTGCGCAGGCGCACGAAGCTCTATGATTATATAAGGGCGGGCCTCGTC
CCTGTCTGTCCTTTCGCGTCGGCGGCGGTTGGCTCGGGGTTGATCTGTAGCATCGTGGTC
TCTCGCACGATGTCTCCCAGTGTCGAAGCCCCGCTTTGTGTGTGGTGAGTGAAGGCCCAG
CTGCGCTCCATCTTTACCCCGGCCGTCTCGTCGACTCTGCGCAGGTCCCCCCCCGTCTCC
CCTGGGGTCGCCCCAAGGCCGCGGGCGGAGGAACTGGCGCGGCTGGTGTACATGATGACC
TCACTTTTTTCCCCGTCAGATCGGCCATGCTGAGGTCTCAGAACGCTTGCCAGTTGATTC
TGATACGCCAGCCGCGGAAGGCCGCGCTGGTCGGCTCTGGGCGTGGGGAGATGGCGACCG
ATCCCTTCTCTCGTAGGTCCGAGGGGACGGCACGGACGTGGGAGGCCGGAGTGACCTGGG
CTTGCGCGGGAGCGCCAGATGCGGGCCTCGAACCTCGGTCTGCAGGGTAAGCGTGTCGTG
GGGACACGTGCTTCGCGGAGCTCCCTCCGGGGGTTAAACTGAGCATTGGGTAGTTGGTCC
TGTTGGGGTCGTCACTTCCGGAGTGAGGAGTCAGCGGTTCGCCCCCAGTGTGTCCCCGGC
CCCGCACTTGGGCACCCACCGTCTGCTCCGACGCGCTAGCAGGAAGCCACGTCTGGAGCG
AGGGCCCGGAACGTGAGCCTGCACCCTGATGAGGCGGGGCCTGCAGGACCGGGGGCTTAG
AGCTGGCTCTGGTCCTCTACGTAGAGGTTTACTGATTGCAACGGCAGAGGTGCGGAGGTC
TTCCGTCCACTGGTTCACGTCCCAAATGACCGCAACAGCAGAGGCTGGGCCAGGCTGGCG
CCAGGAGCTGCGGCCGCGTCTCCCACGTGGCTGCAGGGCCCAGATCTTGGGCGATCTTCT
GATGCTTTCCCAGCCACATAAGCAGGGAGCTGGATAGGAACTAGCAACCATGTGGGTTTC
GGGCCCTGTAGGCATAGCCTACCCCACAGTTCTTTAAAAGTGCTTTGTTTTGTATCATAA
TTCATTGATAAGTTCCTAGAGAAGAAATCCTTTAAGAGACGTTTCCAAAGTGAAGCAGCC
TTAGAGAAGTGATGTTTAAAATCTTTAATGCCACTTTTTTAAATTTGAAAGGCAGTTACA
GAGAGAGGTATTCCACCCGCTGGTTCGCTCCCCAGTGGCTGCAATAGCTCTGGCTGAGCC
AGACCGAAGCCAGGGGCATCTTCCGGGTCGCCCATGTGGCTGCTGGGGCCCAGAGACTTG
GGCCGTCTTTGATCAGGCATCTAAATTTCTTTGCACTCGTGCAGCAGTGAGGTACTTCCA
GGGTGTGCTGTCTGTGGACGCGGCCCTGGAATGTTCTCGCCTTAGCCAGAGCCGTTACTC
GGACAGTGGAAGCTCTGACAGCAGAGGTTCCGAAGTGGTGTGGGGCAGGAGTGTGCCCAC
CGAGCTCCCCGCTGGCGTGTATGATGACTGGATTTTTCCCCGGCAGATCGACCGTGTTGA
TCTACCTTCTCTAAGCCAGTTTCTGTCTGACCCGCCAGCCTCGGCAGCACGCCGGATCCT
GCCGGCCCAGGCGCCGGGGTGACGGCAGCTCGCCTCTGTTTTCTTCGCAGGTTTGTTCTC
GGCGGACGCCATGCTTGGGAGGGACCTAGGTGACCCCTGTGGGGAAGGTAAGCTGAGCCC
AGGTGGCCCTCAGCTCGCGAGATTGCCTCCTGGGCGTTGTACTCGCCCAGACTCACGCGG
CGCTTGCAGGTGATGACATAACTTTCTTCCCCATCAGATCGACACTGTTGATCTAACTAC
ACGATTAGCCAGTTTTGTCTGATGCATTGGCCACACAGGAGCTCTGGTCCTGCTTCCCTG
CACTCTAGTGTGGGTTGTGCTGGCTCTGGGTTCTTCTGCTCAGAGGTCATCTTGGCTCTG
TCCTCTCCCTACAGATCAGGAGTCTGTGTGGCAGTGCGTCGGTGTCTGATCTTCGTCCTG
TAACAGGTGAGTTCGCTGCTTTCCGCCCTCGATCCCATAGCAAGGTGATGTGCACCCTAG
GGCCTATAAGGAGTTTCAGCCCTTCTTCTTGACGTCCGGGTCACCTGACAGTCGGGATTC
AGCTGATAGTTGTTACATACAGACCTTCAAGTGTGTAGAAATGAATGTTTTCTCAGTGGA
TCAAATGTGTGGTTCCCTCGTTACTCAGGGTCTCACTTTCTGAAATTTTTAGGTGAAAGG
CAGATGCCAGCGGCTGGGGCCAGACTGTGCTGAAGGTGGACACACCAGCAGGAGCTGGAC
TGCAACGCGGGCCACCACACCTGTCCCTGCAGGTATGGCAGTAGTTGAGATTAGAAGTGT
TGACCTCAGACGCGTTATAAAATAGTTCTGTAGTCACAGTGCTGGAAGGCAGTTTGAGGA
AAGATCCACTGGTTCACTCCCCAGCTGGCTGCAGCAGCTGGAGCCGGGAGCTTCAGCTGG
TCTCCCACATGGGAGGCAGGGCCCAGGCTAATGCAGGGAGAATGGATAGGAAGTGGACCA
ATGAGGACTTGACCCATACGGGATGGTGGCTTTATCCACTGTGCGTTTTGGATGTCCATG
TTCTTTTGTAGCTGCATTTAAATTTAGCTTATGTATTGGGAATCAGAGATGATCCTATGG
TCTGTCATTTTTAGTTGTCTAGATTTTTCTAACCCCATGTTACCAGGAAAAACTCATTTT
TAGGTCAAGATAATTAAGTACAATGTTCAAGGTGCAGAGTGATGTATGCATCTGCCTTGT
GGGTGGACTTTGTCCAGAAAGCTCCATGTCCCTGACACGTAGTCCCTAACGAGCACAGTG
CAACCACTGAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved