Oryctolagus_cuniculus Locus Mono:91:SNORA9
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:91:SNORA9
Oryctolagus_cuniculus
Mono:91:SNORA9
scaffold_113828
SNORA9
1001..1134
2134
CCCCTGTACCTCTTGTCTTCTTGCTTTTCATCTGGCCGAAGATTATCTATGAAATCTGG
CAAAGACATATTAATTTGAAAAGTTATTTTGGATATTTTTAAAATGTCAATATAATTGGA
CAAAATTCTTAATTTACATACAATATAATAATGTTACATTGTGAAAAAGAAAAAATAACG
TGGAGTACCGGCAGAGATTTCACTTTCACTTTAATTTTAAGGCCTAACAGTAATATTTGC
AATCGCATGATTTCACTGGCTCCTTGGGGACATAAATCATGGAGAAGGAAGGAAAGTAAG
AGGTCAGGGGATCACAGCTATCACAATTCCTAGGCCCACTTCAGGAAACATGGCCAGACC
TGAAAGCAAATCTCATGAACATAATTCTTTGCCATAAAAGGCAGTTGTAAGCATGAGGAA
AAAAAAGGCGGGGAGGTAGGGAGGGCAATCCAGAAAGTTACAGAAAAATAAGGACACAGA
GTTAATAAAAAAAAAAAATCAGATGCTTGATACCGCTCCCTAAGAACTATGTGGATACTG
CAGGTCACAAGCTGTTCTCGGGCATTCATGTGGAAACAGCAAAACCAGCCACCTCATCTT
CAAGCACCAGACATATGGAGACCAGAAGACTCAACAAGAATCTGCATTAACATTCGAAAC
TCCCTGTAACTACCAACAAACTCCATTCTGCTTTAGACATCTCAGTTGTGTTTAAGAAAC
ACATGTGGATAAATTAGAAAATTTCATTGAGCAACAATTATGGATTTATGGAATACATGA
GCTGAAGAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGACTGAGA
GTATATAAGCAGAACCTGTTTCAATTATCCATCATCAATTATGTTAAAGTCAAATTTCTT
TGAGGGTATTATGCAAGTCATTTTAGAAATTACTTGACTACTAGCAAGCCTCCAGCACAT
GTGGGCTAGCTGTGACTCTGTGCATTCCTACAGTGTGTGCTGGAACATTCTCCAAACGGT
TTGAGGCATTGCCCTGCTCCATCCAGAGCAAGGTTATTGAACTTTTCAGAACATGAAAAA
AAAAAAAAAAGCACTTGACTATAACAATTCAAGTTTATCATTTTTAGGAAAATTTATAAT
AAAGTTCACCTAAAGCAAAGCAGAAACCTGATTTTACTACATTGATTTATAACTTCTGAC
TAGTTTGATAGTTAAGAGTTTGTTTTACTTCATAAACTTAAAAATACTTTTTAAAAAAGG
GAGACCACTGTAAATCTGCCTTAGAGAATATCTTTTACCTTATGTAAGACAACCTACTAG
CTTCAGGCTATATTAAAAGCATCTAAAATATATGCAGAAATCTGCTATTTTAAAATTGGC
AGGGTAAATATAATCACTAGAAACAATAATTCCAAACTGAAAAAAATGATGTTAAATGTA
GTAAAAGCCTAAATTTAAAAAGAATGAAATCTTGTCTTTTGCAACACAATGGATGCAACT
GGAAACCATTATATTTAGTGAAATAAGCCAGTCTCAAAAAGACAAATACCATATGTTTGC
TCTGATATGTTACAGTTAAAATAGAATACAAAAAATGCATTGGAATGAAGCAGACACATT
GTTATATGACTATCATCTTAGCCCTTGTTTATACTCCTGTAGAACTGTGATCTTCCTACT
TTTTACTTGTTAAATATTATGGCAAGCGGTGAATTAACTCTGTGATTACAGAGTGGATTA
AAATTTTGTCTTTACAAAAATGAATGAAAAGAAAACAAGGGAGGGAAGGAGGGGCACTGA
GGGCAGGAGTGGGGAGAAAGGGAAGTATGTTATCTTCTTAGGACTGTACCTATGAAGTAC
ATGAAATGTTCTCTTTATACTAATTTTAAAACAACTTCAATGTGTTGATTAAATTGGTTT
TATCTACAAATGTTTTAGTTCACTGCTCTTTAAATGAACAGAAGTAGAAGATACTTGAAT
TCAATTCCTGTCCCCTTAGAGGCATCCATGTCTATAAACAGTGTGCCAGAAGAATAATTA
GTGATAAACAGGAGACACAAGTAACAGATCTCTGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved