Oryctolagus_cuniculus Locus Mono:59:SNORA65
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:59:SNORA65
Oryctolagus_cuniculus
Mono:59:SNORA65
scaffold_179357
SNORA65
1001..1127
2127
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNATAGCTGCTGGAGTTTAACCTTCTGCCTCCCAGGGTGTGCATTAGCAGGAAGTTGGAA
CTGGGAAGCAGAAGTGTGACTCGAACTCAAGCACTACAATATGGGAAATGGACATCCCGA
CGGATGTCTTAACTGCCGCACCAAATGCTTACCCCAGGTCCTGTTTTCCAATTACAATTT
TCAGGGGCCAGGAAGAGGTAAAAGAGCCCCTACAAAAACTGAGACTTTTGTGCATTAGGA
AGAAAATCAGGACAGTGTGATGTTTCCAAAGCCCAGAGCATAAAGCGGTCAAAGAGGAGA
GGGTTATCATTTGTATCATTTTCTATTAGCAGGTCAAATAAGATGAGAGTGAAGTAAAAC
CCTCAGGATTTGGTAATGTGGAAATATTTGGTAATTTTTATAAGATCAATTGCAGTAAAA
TCCTAGCAACTGAAGCCAGAATGGAGTGAGTTTAGATTGAATGGACTCGATTAAATTTCC
AGTAAAAATCCAAATAAGATATTTCTCTAAAATTGACAAGCTGATTCTAAAATGCATATG
GAAAAGTAAAATGCCTAGACTAGCCAAATTATTCTTAAAGGACAATTGTAGATTTTTCAC
AGCAGATATCAAAAGTTGTTAAAAATCTACATTAGTTGTAGGACACATACATGGACAGAG
TGCATGGCAGATTATTCAGTAAGTGGCATAATTGGTTATCCAATTGAAAGAGTAAAACTC
AAAAAAAATCCTATACATTATGTTGTTTGGGGATACATTTCTCAGTCCCATATTAGGGCA
CCATTGTGGCACCATCTCTACACAAGGGCCTCCCTTAGCCACCCACCACTGCGCCTGTCC
ATGCTGTTGGCTGGTGCAATCCAGTGGTGAGCCGAGAGGAAGCCCCGGCTTAGGAAACAG
GGTTGTTCTCCACGTGGATGACTCTGTGCCGAAAGCTCGGGAACAGCCTAGGAAAAAAGA
AAAAAAAAAAAGGGGGGGGGGCCTCCCTGAGGGGAAGGCAGTTTGAAGAGGATGTCACTG
GGGAACTGAAGGATAAGTATTTTGTTCTGGGCCATCCTGCTGAATGTCTCAGGAAGCTCT
CACATCCAAGTACATACCCCTCAACCTCGCCCAGGCTTGACCCAGAGGTGGGATAGAGGG
TCGAACACAGTGAGAACACTGGAAATTACCAATTTCTGTGGTTCCTCCTCTTGATTGCTG
AAAGCTTTAAAAAAAAAAAAAGAAAGAAAGAAATTTTTTCATTTTATTTGAAAGGCAGAG
ACAAAGAGACAGAAAGAGAAACATCTCCCACCTGCTGCTTTATATCACCAAATGATTACA
AAACCCAGGCCAGGCCCAAGCCAGGAGCGCAGAATTCAATTCAGGTCTCCCACATGGGTG
GCAGGGACCCAAGTACTTGAGCTGTCACTTGCTGTCTCCCAGGGTACACATTAGGAGAAA
GCTGAAATCAGGAGCTGAGCTGGTATTGGAACTCAAGTACTCTGCTGTGGGGTGCAGGTG
TCTTAAGTGTTGCAACAAAAGCCTGTCCCTAAAGGCTTCTCTTTTGCTCTGTTAGGCAGG
AATTTGCTCTACGTCCTTTCCTGTGTATTTCTGCATTATGACTACTTAGAATAAACTACG
GTTTCCATTTCTCCATGCTTGGCTCTTTGTAAAGCTTTTGGAATTTTGAGTCAATCTTTT
TATGTCTCAAAAAGCCAGAATGGAAGTTGACAGTAGAATGGTGGTTACCAGGGCCTGGGG
AGAGTAGCAGGCCTGGTATTGGCAAGGCTAATGGGTTCAGGTTCTTGTCTCCAAAGCACA
AAAGAATTTGAGAATGAAACGTAGATAAAGGTTAGCAGAAAAAATAAGATTTATTAGCAA
AGCAAAAGTACAAACTCAAGAAGGAACACTGGCGGGACCAGTGCTGTGGCATAGCAGACT
ACGCCTCTGCCTGCAGCGCGGGCATCCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved