Oryctolagus_cuniculus Locus Mono:87:SNORA7
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:87:SNORA7
Oryctolagus_cuniculus
Mono:87:SNORA7
scaffold_114612
SNORA7
1001..1138
2138
AGCTCTCTGCCATACCCTGGGAAGGCAGTAGAAGATGGCCCAAGTCCTTGGGTACCTGC
ACCCACGTGGGAGACCTGGAAGAAACTCCTGGTTCCTGGCTTTGAATGGGCGCAGCTACT
GCCATTGTGGCCAACTGGGGAGTGAACCAGCAGATGGAAGACCTCTCTCTCTCTGCCTCT
CTTTCTCTCTCTGTGTAACTTTGACTTTCAAATAAATAAATAAAGAAGAAAGAAATGACC
CAGCCACTCCACCAAAAATTATGTGTCTGCAAAGAACTGCAGTTACTAAAACCAGAAGCC
ATACACACAGGTTCACAGCAGCATTATTCACAACTGCCCACAGAATTGACTGGCAGATGG
ATGTCAGGAGTAATCTACCTATGACATGATATAGTCCTCAGCCACATAAAGAATGCAGCA
GCAGGGACGCAGGCCATGCCTTGGACCTACCTTGAAAACATTCAAAGTGAGAGCAGCCAA
ACACACAAAAAACCAATATTGCGTGATTCCTTTTACATGAAAGACGCAAAAAGGATAGAG
ATGGAAACCAGATGAGCGGTCTCCAACGACTGAAATTGGTGGGGAGGGTAATGGTGACAG
TTGCACACCGTCGTAATTGAACTAAGTGTCTCTAATGGTAAATTTGATGTGTATTTTGTG
ATTAAAAAAAACAGCAAGGGGGGCCAAGCTGGCATGGCACGGCAGGTTCAGCTGCTGCAT
GCAGTACCAGCATCCAGTATGGTGCCCACTGGTGTCCTGGCTGCTCCACTTCCTGTCCAG
CTCCCTGCTAATGTACCTGGGAAAGCAGTGAAAGATGGCCCAGGTATTTGGGCACCTGCC
ACCCACATGGAAGACCTGGGTGAAGCTCCTGGCTCCTGGCTTCAGCATGTCCCAGCCCCA
GCCACATGTGGAGAGTGAATCAGCAGATTCAAGATTGCCTTCTCTCTCTTTAACTCTGCC
TTTCAAGTAAATAAAAATAAATCTCTTTAAAAAAATATGAAGACCTCCCGGGATCGCGTC
TGGAGTGTGGCCAGTCTTCTGCCAGCTTCGGAAGCGGGAGGGAAAACAGGGCCGCACAGG
CACCGTTCCATTCCCAGTTTGCTCAGTAGCTGGTGATTAGAAGACCCTCTGCAACGGTTA
AGGAAAGGACTGGGACCAGGGATCAAATCTCCCTCCAGAGGGGGCAGGCGTTTGTGGCAC
AACAGGTCAGCGGCCTCTTGGGTCCCCCACATCCCTCAGAGTGCCTACCATCAAGTCCCA
CCTCCACTTCCTACTGATGTGCATACTGGCAGGCAGCAGGATGGCTTCAGTATGTGAGTT
CCCGCCACCCACACAGGAGACCAAATTGAGATCCTGGCTNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved