Oryctolagus_cuniculus Locus Mono:142:SNORA33
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:142:SNORA33
Oryctolagus_cuniculus
Mono:142:SNORA33
scaffold_208225
SNORA33
1001..1129
2129
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTGCCTGCCCGAATAGTTCCCTTTTAAT
TTAAACTTGGTTGTTTCAGTAGAGTGTATCTTTTTTCTAAGCATGCAACTATAGTTTTAA
AAATTAAAATATGTAAAAGCAATTTTATTCCTTCTTTTTACTGTATTTGCTAGGAATCAT
AAAATATTGCTGAAAAATAATGGTGATAGACCATCTCTAATATCTGGTTTAAATTGACGT
GGTTTTATTGTTCTGACATTTAGGACACCTTTTGTTGCTTTCTAAAACTGACATTGTTAA
ATTTATTCATTCAGAACTATTTGGTAAAGACTCTTTATTGGTCAAGTACAATGAAAAGCT
TTGTAAATAAGTCTGGGAACCAAAAACAACTTACCAGGTGGATCATGAAAGCAAGGATAG
AGGTATATGGAGATTTGTCCCATTAGGGTAGTGACGATGAGAGTCATTGATATGATTTTT
GAGCAAAGAGGAGGAGGAGGAGAAAAGTTTATGGCCATGCATTCTAGGCTCAGGGGCTCT
GCTCCATAAGAGAGAACCCAGAGTTTTTTCGTTTTTTTCATTGTGCCTTTTCTTAGAGTC
CTTATAGGGACTTGCTGTTCAATGTGATCTAGTGTGATCTCAGAATTTTTAATGAGGGAG
GAAAACTTGCACAAGGATATTGCAAACAGTTGGTAGGAAAAATGGAATTAAAAGATAGAT
TCATTTTGGTGGTAAAACTTTTTTTAAAATCCATGCATTGAAAGCCAGCCAATGAATCTG
CTTACCTGTTGTGTTTCTGCAGAAATCTAGAAAATCTGGGCAATAGTAATGCCATGTTAC
GAACCTTAAAGACATCGAAGTCTTTCAGGTCCCTGAAAATGGCTGCAACAACAACAACAA
CAACAAAAAATCCATACATTGTTTTACTTATAATGTGTATTATCTGTGGACCTTTTGGAA
ACCTCAAGTGTATTTTTAAATTGAATAAAACTAATTATTGATACTAATTTCCTGATATTT
ATCCAGGCTTGTCATTTTTTAATAAAGCCCTCTTGATTATGGCATAGTCTGGCACTTGCC
AGATTTTTTAAGCTAACACTTTATTCACATTAATGGCCTTTGGTTCTTCTTACTATTTAT
GGAAACCTTTGTTATTATAATTTTCCTTTATCAAAGTGAATTGGAGAGACTTTCATAATT
CTTCCCTGGAGTCTTAAGGAATTAGATGTAACTCAGCATTACTCTTCTGTTCCTAATTTG
TTGTCTTCATTAAATTACAACTTGTGTCAGTTGTGATGCTTAATTTTAACTTGCTTAATG
AATTTTAAACTAATCAGTTGGCTACATAATAATAAGATAACAAAGTGAAGTAATGTCTGA
ATCATCTTAGAATTAAGATAGATGTTGAAATAGTATTTCTATAGTTATGTGAACTACCCA
ACAATAATTCTACTTAAAGTTTAACTTACCTAGGGTATGATTTTTCACAAACTTGTATTA
TATGAAATTTTGTTTTCTTGATACCTTTGAAAATGAAGGAGTGATTTTATGCTGTATCTT
TAAATAATAAAATTGCAACAAACCTTTCAACATTCTTGCCTTGCCAAATTAAATGGCTCT
TTCACATATTGAAACTGAACAGGGGGCCAGCATAATGTCACAGCAGATAAAGATGCTGCC
TGCAATGCCTGCAACCCATATGGGCAACAGTTTTTGTCCTGGCTGATGCACTACTGTTCC
AGCTCCCTACACAATGCCTGGGGAAGCAGAGGAATATGGTTCAAATACTTGGACCCTTGC
ACCACTGTGGGAAACCAGGATGAAGCTCCTGGCCTTGGCTTCGATCCGGCCCAACCACTG
TCATTGCAGCCATTGAGGGAGTAAACCAGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved