Oryctolagus_cuniculus Locus Mono:66:SNORA28
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:66:SNORA28
Oryctolagus_cuniculus
Mono:66:SNORA28
scaffold_199843
SNORA28
1001..1126
1723
GAGAAAGGTTTTCTCTTCCGTTGGTTCACCCCCCAAATGCCCCGCTATGGCTGGATCTG
CCTCAATCCAAAGCCAGGAGCTGGGTGCTTCCTCCCAGTCTCCCATGTGGGTGCAGGGCC
CAAGCACTTGGGCCATCCTCCACTGCCTTCCCAGGCCACAGCACAGAGCTGGCCTGGAAG
AGAAGCAAGAGACTAGAACCGGTGCCCATATGGGATGCCGGCGCTGCAGGCAGAGGATTA
ACCAAGTGAGCCATGGTGCTGGCCCTAAGGATTTCTATTCTTGATTTTCTTTTGACAGGT
TGTAGTTTGTAAGAAAATGTCTATATCTAATTTGTTGGCATATATAATTGTTCATAGTAG
TCTCTTATGATCTTTTTTTAAAAAATGTTCCATGGCATTGATTGTAATGTCTTTTTTTCT
CATTTTTCTACTTTTGTCTGACTCTTCTGGTTTTTCAGTTAGTTTAGGTGATGACTTGCA
ATTTTTACTTGTCTCTTCAAAATCATCTGTTTTATCACTTATTTCTATTATTTCTCATTT
TCCATTTTTAATTATCCTCTTCTTTCTGCCATCTTTGGTCTTATGTTCTCCTCTTTCCTG
TTTTTTTTAGGTAAAAAATTAGGAGAAACAATTCTCAACTTTATTGGTATAAAGTTCTCT
TTAGTACTGCTTTTGCTACATCCTCTAAGTTTAATTTCACTGTTTTCATTCTCATTTGTC
TCAAAAAAGTTTTCTGATTCCTTTTTGATTTCTTCTTGAACCCAATGATTGTTCAATACT
TTTTTAATTTTTCTGTATTGTGAGTTTTCCATTTTCACATTTCCCTTCTGTTATTAATGT
CCAGTTTCATTTTACTGTGTTCAGGAAAGATACTTGCAATGATTTCAGTGTTCTTAAGGC
TATACAAAAACTATAGTATTTAAATGAGAGCCTTTAGGTTTATAAAGTTGAAGGATTAAA
ATTTATAGCTAATAAACACATTAAAAGCCAACATCTCTTGCAAGCTACACTCTAAGGCAG
ACTGTCAAAACTGTCTGACACAATTTGAACTTGCCATAGCAAGGAAGTCTAACCTATTCC
AGTATTCTTTCTTCTGTGAAACAAACTGTTATAGAGACTTAAACAGTGTTAAAAAAAAAA
AAAGCCAACATCTCACTTTACACATATAAAAACAGTGAAAGCTAAAAAACTTACCCCAAA
ACACAAATATTGGTAAGGTCTGTAATAGCAGTGTCCTATGTTCAGTGAAACACTGATATT
CATAAACAAGGCCTTCATGGATATATAAAAATGTAAATAATTTTGTCAGTTATGGAAAAA
ATGGAAACTAATAATATCCTTAATGTAAATCCACATTTTTTCTCATCCACTAAACAGATC
ATAATTCATAATAGGGATGGAAATATTTGTATTTTCTTCTCATTTGACAAAAGAAAAAAA
GAGTATGGCTCCAATTTGTGTGCTACTACCACATTAATCAAACATTTTTAAAGTAAATGA
GAAACTTTTATAAGGAAAAGATCAGGATAGCTTGAGTAAGTGCCATTTATACTAAAATAA
ATACTAAAATATGTTTTTGGGAAAATAGGCTACCATGATTATGTTAAGAAGGAAACCTAA
CTGTTCGCTCAAGTATCTGTTCAATTGGCTCATCCATTGGAAACAAATAGATGCTCATGT
AACGATGGGAGAGTGTTTCTTCTGCGGTCAGCTGGTCCATGGGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved