Oryctolagus_cuniculus Locus Poly:31:SNORD91
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Poly:31:SNORD91
Oryctolagus_cuniculus
Poly:31:SNORD91
GeneScaffold_3398
SNORD91, SNORD91
1001..1097, 1814..1907
2907
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNTCAGAGTCTAGAATTCTGTTTATGTGACTGGCATTTTGCTCATGGAG
ATGAGAAAATTGTGTCTTTATGATTGAGAATTAGAGGCTAGGAGAGAAGTCAATGATGAG
TTTTACCCAAAATGTCTGAACCTGTCTGAAGCATCTTAGTGATGCCTTTTCTGTGTAGAT
TCTGAGACTTCTCTGAGATAAGAAGGTTTTCCAGGTTAGACTTTGAACAAGTTGGCAGCT
TTAAAAATAAAGGTTTATGCCAAGGTGCAGACTTGATGGTGGCCAGTATTTGTGTATGTT
GGGTGTTATGTACCATCCCTGGCCTTTAGTCAGTTCCGGTAAGGGTAAGGGTTGAGGAAG
CAGAGGCTTGAATGGATGTGGCTTTGAATTGAGTGGTGAGCGAATAACTTGGAGGTCACT
GATTTTGTGGCAGATGCAGAAGGTAAGCGAGCATAGAGGAGTACATGATGAGAGCTCTCA
TCCCAGTGGTTGGTAGAGGGAAGAGTATGTGCTATCATCTATTCTCTACCCTTAGCATTG
TTACTCCCTAGGGTGAATCTGAGCAGCCTGCTGGTTTGATTTGCCTTCTTTCAGATCAGG
CTTGTATTTCCAGACTGAAGTGTGTGTGTGTGTGTTTCCCCCTTACCTGGTCCTCAGATG
TCAGTATTGAATATGGTGGTGAGGCGGAACCCTGGTGACACAGAGCCTGTGAAAGCCAAA
GAGGAGCTGATCTTCCACTGTGGGTTCCGGCGCTTCCGAGCTTCACCATTATTCTCTCAG
CACACTGCAGGTCAGCAGTGGGGAAGCTTCTGGGTTCTTGTCCATCATACCGTCTTTGGG
GAGACTGACTTGGGGGAGGATTGTATAATAGTTCCAAACTCTCTGAGTTAGAGGTTATTT
TCAGTATACTCTGGCTTAGGAGCCAATGATGTTTTTATGCAAAATGTCTGAACCTGTCTG
ACGCATCTCAGTGATGCATCTCTATGTGGTGCTGAGGCTTCTCTGCCATAAGTAGGTTTC
AGTGTAGGTTTTGAACCATAGATGGCAACTTTATAAAAAGGGTGTGTCACGTTGTTGGAC
ACCTTGCCACTGTGGGTGAAGGGATGGAGGCTGGGTATGGGCATAGTTGGGTAAAGCCAG
GGAGGTGTGGGCTTTGGGATGTTGAGGCTGGATGAGAGTTTGGAGAGTGGTGACCAGGGA
CAAGGGCCTTCTGAGTATCACCCTTGCATAGCACACTGGTTGCTCGCTTGGCTCTCAGCA
ACAGCAAGAGAAGGATGAAAGCAGTAGGAATTTTTATTCTCACCAACCATGCTCTCTAAA
TAAGAGATTCATTTCTCTTTCCCTTAAAGTATTCCATTTTCCTATGTTTCCTTAAGTTAT
AAGTTATATAAAGGTTGGGGGGGAAGGTTACATTGAAAGTAAAACTGAAGTTGCAGGTAG
TCTCAAGATTGGGGGTGAACAAACTGTGGCCTTGAGGCCAAATCTGCCCCATCACTTGTT
TTTGTATGTAAACAAAGGTTTATTGGAACACAGTCAGAATTTTTATTTTTTAAATTAATT
TATTTGAGAGGGAGACAAGACAGAGAGCCCCAATCTGCTAGTTCACTCCCCAAGTGCCTG
CAATGGCTGGGGGCCAAAACCAGGAATTCAATGCAAGTATCCCAAGTGGGTAGCAGGAAC
ACTGTCTCCCTCCCCTCCAAACTATTTGAGCCATCACCACTACCTCCCAGGTTCATAGTA
GCAGCAAGCAGGAGTCAGGAACAGGAACCAGAGCTGGGGATCGAATCTAGGCACTTGGAT
GTGGGACATAGGCATCTTGAATGCTTGGCCAGATGCCTGCCCCTATACTTTTTAAAATAT
TCAATGTATGGCTGCCTTTGTGCTAGAATGGCAATGGTTGAGTAGTTTTGACAGAAACTG
CATAGCCACAAAAGCCTAAACTATTCACTCTCTGGCCCTTTACAGAAAATGTTTGCCAGT
CCCTGTTCAGGATCAAGAGTTGTTGATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved