Oryctolagus_cuniculus Locus Mono:141:SNORA27
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:141:SNORA27
Oryctolagus_cuniculus
Mono:141:SNORA27
scaffold_153465
SNORA27
1001..1124
1903
ACAAAGGCATAGAAATACTAGAAAAACATGAAGGACCATGTGAGGGACAGTGAATGCCT
TTGTCACGGACACAACGGAAATATTTTCTCAAGCCAGTCATGTCTGACTTAACAATAGCT
AATGTAAACTGATGGTAAGAAGTATTTCTATAAAGACTTGTCTTTAATTAAACCTCACCC
ATCTATAATCCAGGTAAACAGACTTAAAAGCAAAACACAAAACTCGGTATCANNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGACATCAATGTTATATGTTAGAGGTAA
GTAGCCCAGCCTATACATCAAGAGCGGAATTCTTTTTTTTTGCCGTCAATGCCAACTCCA
CAATTAAAATTAAATCTTTAGAGGAGCCCCACTCATTAATTTTAAAAGTGTGTCAATCAC
AAAAAATAAATATCTAATTTTAAAACATAGGCAATGAATCCGAATAGACATTCTCCAAAT
AAACATAAAGAACAATATTCACCTCATCGGTAATTGAGGAAATTCAAATCAAATCACAAG
GAAGACACATTTCTTCTTCCAATGGGATGATATTAATCAAACAGACAGTCAACGACAAAA
CAGCCCTGAGGAATTAAAGAAATTGGGATGCTTGTATGTCATTTTTGAGAATAGAAAATG
GTGCAATCAATCCAGAAAAGCTAAGCAGCTCCTCAAAATATTAAATACCAAGTTACCACA
AGACTCAGCAATTCGCTTTGAGGTACACACCTGAGGAAAATTAAACATGTCAGCACAAAG
ACTTCTATAGGAATTTCATAGCCGCATTATTCATAATAGCCAAAAGAATAATAGCTCAAA
TGTTTATCATTTGTTAAATTCATAGACAGAAGATGATATATCCACACAATGGGACATTCA
TATTATTCAGCAATAAAAATGAGTGAAATAGTGTTACATGCCATCCCCTTTTCTCTTTGC
CAATTGAACCTTTATATCTTTATTGGTCATTCAATTGGGGCAAAGGAACTATCCTTTTAA
TATTCAGGCAAACTGAGTGTCTTGTAACTGTCAGAGGAAAAAAAACTGAAAAAAAAATTG
ATTCATGCTGTAATATAAACGCTTGTAAATATCACGCAACATGAAAGAAATCAGTCACAA
ATGACTGCATAGTGAATGATTCTTTTATATGAAAGTTCTATGATAGGCACGTTTGTACAA
GTACAGATTGCCTGGGCCTGAAGATGAAAGTGGGGCAGAACAGTAAGTAACTGCCATGGT
TTTCTTTTGGGGTATGAGAAAGTTCTAAAATTCATTACAATGATAGATATGTACATCTAT
GCATCCACTGAAGGATGGTGAGTGTAAACTTCAAATGGGTGAATTAGACAGTATGTGAGT
TATATCATAGCAGAGTTACTGAAAACTGTATAATTATAGAATATTCAAAAATACACCCGT
CTACTTTCCTCATACATACATTATCTCAAAAAAATGAAAAAGAGTTGCTTCAAAGCACTC
TCTTCTGGGAGTAGGCCTTGTGCTACAGCAGGTTAAGCTGCTGTTTGTGGTGCTGTCATC
TGATATCAGAGCACCAGTTCATTCCAGCTGCTCTCTCTCCAAGCCTGCTCCCTGCTAATT
TGCTGGGAAAGCAGCTGAACATGGCCTAAGTACTTGGATCCCCGCCACCCACACCGGAGG
CCCAGTTAGAGTTCCTATTTCCTGGATATGGCCTGGACCAGCCCTGGCTGTGGCAGTCTT
TTCGGAAGGGAATGAACCAGTAGGTGCAAGATCTATCTCTTTCTCAATCTTTCTCTGACA
GTCAGCCTTTAAAATGAATAAGATAAATATTAAAAAAGGATTGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved