Oryctolagus_cuniculus Locus Mono:178:SNORA61
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:178:SNORA61
Oryctolagus_cuniculus
Mono:178:SNORA61
GeneScaffold_5848
SNORA61
1001..1127
2127
GCTGGGACGCCCCTGGCTGCTCCGCTTCCCGTCCAGCTCCCTGCTAATGCGCCTGGGAA
AGCAGTGAAAGATGGCCCAGATGCGTGGGCCCCTGCCACCCCAGTGGGAGACCCTGATGA
AGCTCCAGACTCCTGAGCTGGCCCAGCCCTGGCCATGAGGCCATTTAGGGAGTAAATCAG
CCAAAGGAGATCACCACCGCTTCCCTTCTCTGTAACTCTGCCTTTCAAATAAATGAATCC
TAGAAAATAATACTAGCAGGGATGTGGTGCCTGGGGTTCAGGCTACGTTTTAGATGCGTG
CTCTCATTATCACCCTAAACACCAGCCAACACATTGTCACACTACAGAACTCTGAATTGG
AAAATCTGTCACCATAACCAATGGCACTGATATCTGGGGTCTCTGGCTTTTGGCCACGAA
TGGTAAAGTGCCAAGTTGTTTTTACTGGTTTCCTCACTTGGGTCCAAGTTTCCTAATGAT
GGAGTCAGGAGAATATAAAACCTAAAACTTCTGTTTGGTTTGACGGTCGACACTGTACTT
TAACAAACCTGATCTCAGTGGCTCTAACCAACTGAAAGGCTCTCTCCTCTCTTCCTTTCT
CAGCAGACCCAGGAGGCCTACAGACACGGTGACCAATTTTCACCACCTTGGCTGATATTT
TTCCATTAAACTGATTTTAGACAAGTTACTCCTAAAATGCCCGGATTCTGAGCAAGGTAA
TTTGATTTCTCTGCTACTTCCCTGGCTTATTTTACATTTTCTATTTCAGTGCTCCACTTT
TTCCCTTTTTAAGAACTTAAATTAATAGCAATAACTGAAGCCAAAGAAGGTGGAGACAGG
AAATGCACTGTTACTTGTAAACAAAAATAGTGGCGCTCATTCATAATATAGTTATGTAGT
GTCAGCATAGAGGTTGATCTTGTCTTCGTGCAAATCACTCAAAACTAAATGGAAATTTTT
GTTTTTGCAAACATGAAGGATGGATTCCTCAGTGAAAGTGAAAGCAAATCAGCCCTCCCG
TCCCCAGAATGCTGCTGGTGGTGGTCATACAAGCAGGAAAAGTGATACTGAAGCCGGCCT
CAGAGTGCTATAGTCTGATATATAGCACTGGGCAGGTTTCAAACAAGTTTAAAGTTTAAA
ATAAAATAAAAAAAAGCTAATCAACCTCCATTAAGATGTAGGATTGGAGGGGCTGGAATT
GTGGCGCAGCAGGTTAGGCCACCGCCTACAAGACCAGCATCCATGTGGGTACCAGTTCCA
GCCCCAGCTGCTCCACTTCTGATCCAGCTCCCTGTTAATGTGCCTGGGAAAGCAGCAGCA
GCAGACGACCCAAGTGCTTGGGCCCCTGCACCCACATGGGAGACCCACAGGAGGCTCCTG
GCTCCTGGTTTCAGCCTGGCCCAACTCTGGCCATCTGGGGAGTTAACAAGCAGATGGAAG
ATATCTCTCTGTCTGCCTCTGTCTCTCTTTCTCTGTAACTGATTTTCAAATAAAATTTTT
TAAATCTTTAAAAAAGAAGTTGTAGGCTTGGCCATCTACAGTTGGCCATGTCTCTGTTAC
ACATGTATCACATCAGGAGAGTTGGGCCAGCACACTACTAGCTAAACTCATGGACTGTAT
GTGGCTGCAGTTAGTAAGCACTGAACTGACACGCATTTTTCCATGAAGCATGAATGTCAA
TACAAGCACCCACAGTTTGAGGCACTTTTTAAAGTATAATGTGAATTACTCATTTAAAAC
AAGACAGGAGGCCGGCGCTGCGGCTCAATAGGCTAATCCTCCGCCTGCGGCACTGGCACA
CTGGGTTCTAATCCTGGTCGGGGCGCCGGATTCTGTCCCGGTTGCCCCTCTTCCAGGCCA
GCTCTCTGCTATAGCCCGGGAGTGCAGTGGAGGATGGCCCAAGTGCTTGGGCCCCTGCAC
CCGCATGGGAGACCAGGAGAAGCACCTGGCTCCTGGCTCCTGCCATCGGATCAACGCGGT
GCGCCGGCCACAGTGCACTGGCCGCGGTGGCCATTGGAAGGTGAACCAACGGCAAAGGAA
GACCTTTCTCTCTGTCTCTCTCTCTCACTGTCCACTCTGCCTGTCAAAAAAAAAAAAAAA
AAAAAAAATGTAATTAACATAATGGCTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved