Oryctolagus_cuniculus Locus Mono:107:SNORA49
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:107:SNORA49
Oryctolagus_cuniculus
Mono:107:SNORA49
scaffold_213216
SNORA49
1001..1134
2134
AGTATCTTCTTTCATTTTAAGTGTCTTCTTTCATTTTAAAAAGTATTCAGATTTGGTCA
ATAAATTATTTGGTCACCCTATCAAAACATTTGTGTTTGACCTTTACAATTTGAAATATC
TACACAATTTATAAGCTATATAATTTCCTAAACCAGATGCTATTAACTATTTATCAATAG
TCTCTACAACTCAAGGAAAATTAAAAAGAAGTAACTATTATGTTAATAAAGTTAGAATCA
TAAAAAGGGAAGTATAACTATTCCTAGTTTTAGGCTTCTTTTAGGACTCAAAAGGGGATT
ATCAGAAATAAAACCTATAGTAATTACTAAGAATATTAAGTTGCACAGATATAAATGAAT
ATATGAAAGTGAATTTCTTCCTTTATATTAAAAAAAACAGAAAATACTATGGAAGAAAAT
ATTTGAATTACAAAAAAATGTATAGATAGAATCAATTTATCTATAAAGATTCAAACACCA
AAGAAATAATCACTCAGGTGATCTATTTTTCTGTCAATTCTTTCTTTTTCTTTTTTATTG
AGTTGCACAGAGAGAGGGAGAAGGAAAGAGAGGGAGAGAGAGGGCTTCCATTCATTGGTA
AACTCCCAAAATGGCTTCAATGGCTGGAGCTGGACTGGTCTGAAGCCAAGAGCCAGGACC
TTTTTTCAGGTCTCCCATGTGGGTGCAGGGGTCTAAGCACTTGGGCCATCCTCAGCTGCT
TTCCCAGGCACACCACTAGGGAGCTGGATTGGAAGTGGGCCAGCCAGGACAGGCACCAGT
GTCGTGTCACAGGGAGTGGCTTTACCTGGTAGGCCACAGCTTCCCCCCCTCTGTCAAAAC
ATATCTTATTTATTTCCCACACCCTGTTAAATAAAACGTAAAGGCTAATCTTAAGCAGGA
GCATTTAAGGAAATAAAAATGGCGCTTTATGAACAATGTTGTGTTAAGTGCTATTAATCA
GAATAGTATGCAAGAAAAAGTTGCAAAGGACCATAAAACATAGTCATAATGTTTTATTAT
AAAAATTTACTGTTTTAGTGCCCTGGCATTGCCTAAGGATAGATAAGAAAGCACAAATCC
CTTCCCACGAAGATTCAAACTTCTTCTTCTGAGGCCTACAGATTGACCTAATAGCAAAAA
AGAAAGAAAAAAAATTGTTTTGCTTTTGCTTTTCTTATTTTCCCACTTCGTATTCTTTCA
CATAAAGGAGAAGCTAAAATGGACAATGATGTTACTAAATCTTGAAAGAGTAGTCAAATG
AGAAAGTACTACTCCTTAGTACACTTTTACAGAGGTATAGCAGATGGTGAAAGGAAAAAA
AATTAAATGTCTATTTTTTGTCCTTTTGTGGAAAGCTGAATTTACTTTTGAGGAAAGAAT
AAGAAAACTGAAACTAGTGGCTAAAAAAAAATGCTTGTGAATATTCTATCACTATTTTTT
TTCTCTAAGAACTCTGATAGTATTATTTATAATCTATGAAATTAAAAATTTAAGTGGTTA
AAAACATGTATAAACATGATTTTAAATCACTATTTAGAAATAATTTCATATTTTATGTTA
TATAATTTTATATATAAATTTTTGTTTTGTATTATAACCTTATAATTTTATAAGATTTTA
TAACATTATAATATAAAGTTTAGAAGAAGCTACATGAATATAAAGTGTCTTGTAAATGGC
AGTTAATGATTTTCAAAGAATCATTTTTTTTCTTTAAGTAGGCAATTTGTTTTCTACCTA
CCCTCAAATCCAGCTACAACACTGAACTGTGTTTTAAGTATTTGGTTTTTAAAAATCATG
AAGGGAGCCGGCGCCGTGGCTCAATAGGCTAATCCTCCACCTTGCGGCGCCGGCACACCG
GGTTCTAGTCCCGGTTGGGGCGCCGGATTCTGTCCCGGTTGCCCCTCTTCCAGGCCAGCT
CTCTGCTATGGCCAGGGAGTGCAGTGGAGGATGGCCCAGGTGCTTGGGCCCTGCACCCCA
TGGGAGACCAGGAAAAGCACCTGGCTCCTGGCTCCTGCCAGGATCAGCGCGGTGCGCCGG
CTGCAGCGGCGGCCATTGGAGGGTGAACCAACGGCAAAAGGAAGACCTTTCTCTCTCTGT
CTCTCTCTCTCACTGTCCACTCTGCCTGTCNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved