Oryctolagus_cuniculus Locus Poly:22:SNORD116
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Poly:22:SNORD116
Oryctolagus_cuniculus
Poly:22:SNORD116
scaffold_181458
SNORD116, SNORD116
1001..1094, 3653..3746
4746
CTAGGAGGAGGACGCTGGGGGCCCATGCCCAAAACTGGATTCATCTGGGCAAAGGTACA
GGTGCCTTCTGAGACCTGTGTGGCCAAAGGGTCTCCACTGACAAAATGTGAGATGGAGGG
ATACAGAGTGAAGGAACTAGGTTGGCCATATTGTAGTTGTGCTTTTCTCTTTCCCAGTGC
AACACAGAACTCCTGGATCAGCTGTTGAGGAGGTCCCTTGCTTGTACTGAATTCTGGTGA
TGCTGGAAAGTGACCCAGACCCGCAAGATGCTACAGAGGGCCAAAGACTTGACTGTGTCT
CAGGTCTTCTGAGGCAGCATGCATTGTACAAGTGGTACCAGGGAAGCTGAGTGGGTTTGA
GGGAACTTGTCTCTCAAGGCCAGATGTAGGTGCCCTTCATGGAAAATTAGGAAATCAAGA
AAAAAACCCACAAGGGCCTTTTCAGGAAAAACTTGTGTACCAATACTCCCATGTGGGAAG
ACTGGTTAGATTGAAAGGAAGATACAGGAAAGAGGATTGAGGGGACACGCAGTGGCATGG
AACACCACGGGCAGCCTAAGCCTGGCAGCTCGTGAGCAGGATATGGCTCTGGTTTTCTCA
AGTGTGCCTGTGGTTTGTGTGTACCCCTCAGGACTGGTCGCTGATGATGACGTGGCCAGT
GCATGGTGGAAAGAAGTGTGCTTATGCTGAGGACTTGAGGCCCTACAAGACGCTAGAATT
CAAACTACCCTTGGTTAGCGGGAAGTTCCTGGATCAAAGAGGACGGTAAGCATGGCGAAG
GCCAGCACTGGAGAAAAGCCCATAGCACTTAACAGCCCTGCAGACACCTGTATGGTCTCG
GGAGACTTTGGTCGTGCCTGGGCCACACCTCTGCAGTGGTCGCCTTCCTCCCAAGCTGGG
GCACATCCCTGGACCCTGCGCGGTGCAAAGGTGGTTAGACTGAGCAGCTGATGAAGCAAC
AGGCCTTTGGGGTTGAGGGCCCCACCCATTGGCATGTGCTTGGATCGATGATGACTCCCC
CATAAACATTCCTTGGAAAAGCTGAACAAAATGAGTGAGAACTCACAACCGTCGTTCTCA
TCGTGACTGAGGTCCAGCACGTTGCCTCTGGCAGGGATTATGGCAGTGAGGGCCCACATC
CAGGGTAGCGGTTCTCTCCACAACCCAGGGTGTACCCATGGTGAAAGGTCCATTTGAGCG
GCGCCAGCAAGGCGATCTCTCAGTTGGCCACTCTGGGCAGCAGAGTGCCTGGTGCAGTGG
TGCTGGGAGTTTGCATGACGGCTCCCCACGTGGGCAGCAGTGGTGAAGGATGCAGCAGGG
TGTGCAGGATCTGATTGTTTGGATGCACGCAGGCCAAGTATTCACCTCCATGGTAGGCTG
TGTGCAGCAAAGGCCCAGGTTGTCTGTGCAGTGGGTCTCAGAATCGGGTGGTCCTCTTCC
TGGCCAACAGGAGATACATAGCCTGGTCGCCTGGCTAGCATTAGGTGTCTCAGCTGGTAG
TCTGATGTGGCGGCAGAGTGTTGAGGTCTCTGAAGAGATCAGACATCCCCTTGAGTGTGG
CATTGACACTTGGCAGTAGTGCCTGTGTGACCTGGTGTTAGGTGTCAACCTGGCATGACT
GTTCTGTTCCCTTCTCTTGGGACAGTCTTCCACAGAGTAGAGTGGCTCTTGGGCTGGGTG
CAAAGGAAATGACAGGGACAATGGGATGGGTTGTCTCTGAGGAAACCCTGGTGAGCATGG
TTGCTGTGAGTTCTTCAGGGCGGGGCAGCGAGTGCATCATGGATGACCCAGGGTGATTCC
CGGTGATGTCAGAGTTTGATCATGCAATAGAGTTTGGGCACATGACTGGTACAATTTGGT
TGGTGCCTTGGGGAGATTCTAGGCAAATAATGTGCTGGGATCCCTTTGCCGAGGGTGTGA
GTGTCATGTAATCTGTTGTACTCTTGCCCATGGATGAAGCAGTTATGCAGGACTGTGCCA
CGAAGGCCCGGGTACTGTGCTTCTCCTATTTGAAATGGACAAACCCCCTTTACCTGGGCT
TCAGAGGCAGGACCAGTGAAGTGACACAGTTACCTCAGGAGAGTTAGGACCTTGGGCATG
GTAGCTTCCCTCAGCTAGTAACAACAGCTGTTGGACACTTCAGGGCCTATAACTCATGCC
CCTGGCTCCTGTGCCTATATTCCTGGAGCCCGAGCCCAGATTGTCTTGGCCAGCAGAGAA
ACCTCAATGTCTTGTGGGTGGGAGGATGTTTTTAGAGGCATTTGCTGTACCCTGGGGTTT
TGAGACTAATCCGTTGCCTGAACATACCCTGTCTTGGATGATTGGGTCATGTGGCAGGGC
CATAATCCTGGTGGTTTTCCCTGTCTGTTGGGGGCTCACTTGTGCTGAATGTGGATCGTG
TAGTCCTCTGGGTTGGCAGGTGTGAGGTTGAATCTTTGGTGGGTTTGAGGGCTGGTTGCA
TGTTCCCTTGTGCTGACTTGAGGACATTCAGAGGGCTTGCCAGGGTTGGGGCGATTAGGG
AGGAGCAATTAGGGAGAGGTCACTGGGGTCAAGTCTGACCCTGGGTGCAGCTCGGCAAAG
ACATTGCTGGCCTCCCAGACCTGTGTGACCACTGAAAGAAAAACGAGATTGAGAGATGCA
GGAGTGCAAGTACGAGGTGGGCTGTGTTTGCAGTGAGTCTCTTGCTCTTTGCTGCCGCAA
CACAGAAACCCTGGCAATGTAGAGGAGGTCCCTTGATTGTACACACTACTGGGGACTCTC
AGAGCACACCACACCTGGCGGTGGTACAAGGAGTGAAAATGCATGACTCTGTCTCAGGTC
CTATGAGGCAGTATGCCACACAAAGTGGCCTTTGTTTCCCTGGAAGTTGCCACGGGTTTT
GGGGTGCGCGTGGAAATTTTCACTCTGTGCCAAATGTCAGTGCCCATCCACGGTATTAAA
GGCTCAGACCCCCAGCAAAGCAGTGCCGGCAGGTAGATGTCAAACCTGTCCAGACCATGG
TCACCGACGGCAGGACCAACACATACGAGGGACACGGACACATATATACCGTCACTCACA
TCTTCCCAGAATTTAGAAGTCAAGCTGATAACCCACAAAGGCCTACTCAGGAGAAACTTG
TGTGCCCATAGTCCCATCATGGACAGACTGGCTTGTGTGTAAGGAAGCTTCAGGGATGAA
GATTGAGGGGGGGCGCGGTGGCAGGGGTCACCATGGGCAGCCTAACCGTGGCTCGGCCGG
GGCTCTCGTTTTATCAAGTGTCCCTGTGGTTTTGTGTGTACTTCTCAGGACCACTTGCTG
ATGTCAACGTGGCCATGCAGGGTGGGAAGAAGTGTGCTTCTGCTGAGGACTTGAGGCCCT
ACATGATGCTAGAGTTCAAACTACCCTTGGTGAGTGGGAAGCTCCTGGATCTCTGAGGAT
GGTAAGCATTTCCAGGGCCAACCCTGGAGACAAAGCCCTTAGCACCTCACAGCCCACAGA
GAGCTGTATGCTCACTGTGCATTTGACCACGGTTGGGCCACACCTCTGCAGTGGACCGCC
TGTCCTCCTTGCATTGGGGGGTATCCCTGGACTCTGCAGGGCTGGGAAGGTGGTTGGACT
GAGCAGCTGACGAAGCGCCAGGCTTTGTATGTCTCTCACCTTGGCATGTGCTTGGATCAA
TGATGACTCCCCCATAAACATTCCTTGGAAAAGCTGAACAAAATGAGTGAGAACTCACAA
CCGTCGTTCTCATCGTGACTGAGGTCCAGCACATTGCCTCTGGCAGGGACTATGGCAGTG
AGGGCCCACGTCCAGGGTAGCAGTTCTCTCCACAACCCAGGGGTGCCCATGGTGAAAGGT
CTATTTGAACAGCGCCAGCAAGGTGATCTCTCAGTCGGCCGCTCTGGGCAGCAAAGTGCC
TGGTGCAGTGGTGCTGGGAGTTTGCGTGGCGGTTACCCATGTGGGCAGCAGTGGTGAAGG
ATGCAGCAGGGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTTGCC
TGTGCAGTGGGTCATGGTACCAAGTGCTCCTCTCTGGCCCAACAGGAGTCATGAAGCCCA
GTCCTCTGGCCAGCATTAGGTCTCTCTGCTTGTGTTCTGAAGTGGCAGTAGTCTGCCGCA
GGGCTCTGAAGAGATCAGACATCCCCTTGAGTGTGGCATTGACACTTGGCAGTAGTGCCT
GTGTGACCTGGTGTTAGGAGTCAGCCTGGCATGACTGTGTGTTCCCTTCACTTGGGAGTT
TCTTCCATAAAGTGCAGTAGCTCTTAGGGTTGATGCAAAGGAAATGACAGGGACAATGGG
ATAGGTTGTCTCCAAGGAAACCCTGGTGAGCATGGTTGCTGTGGTTTCTCTAGGTGGGGC
AGAAGGGTATTCCTTGGGTCACCAAGGGTGAGCCCTGGTATTATCATTTTGTGACTATGC
AGTAGAGCTTGTGCACACATCTGGTGCATTTTTGAAGGTTACTTGGTGGGAGGGATAACA
GGTGAGCAATCTTCAGGGATCCCTTTAGCTGAGGGTGTGAGTGCAGCATAATCTGTTGTA
CTCTTGATCATGGATGAAGCAGCTTTGTAGGTCTGTGTCACAAAGACATGTTACTGTGCT
TCTCCTATTTGAAATGGACTCTCTCTTTACCTGGGCCTCCAACGCAGAACCAGTGATGTG
ACGCAGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved