Oryctolagus_cuniculus Locus Poly:9:snoU2_19
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Poly:9:snoU2_19
Oryctolagus_cuniculus
Poly:9:snoU2_19
scaffold_140879
snoU2_19, snoU2-30
1001..1080, 1266..1335
2335
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCATTGAATTCATGAATTCATACCTATTCAA
TGAACACATGCATTCATTCATGTCAGTTGTGCTACTTAAGAAAATATGATTTCTGACAAA
TTATAAATATGCTACATTGAATTTTTCACACTTATATGCGGTAGTTCATGTTGTAATATT
AAAAGTCAAATCCTTATCTGAGATCTGCTCATACCAAGGTGGATCAATGATGAAAATAGC
CAAATCTAGCATCAGAAGACCTTCTAGTCTTACCTCATGCATGATCTCCATTGTTCTGAG
AAGCAAAACTATCATTATTTAAAACAGTATGGGCGTTACATCTGGGGTTTGTGTGTGTGT
GTGTGTGTATGTATGTATGTATGCATGTGTCTATAAAGATGGCAGTGGATAACTGAAGAC
TAGATGGATGAAATGTGTGTGTGTGTGTAAGTGTGAGAGAGACGGAGAGAGAGGCTAATC
TTTTCTTAGCAATGATGAAAAGGTTTTACAAGTGACTTTTATAACTATGAGGTTTTCTAC
ACTTGACCTGAGCTCAGAAAAAAAAAGTCAAATCCACATAAATATGATTTTCCTCTGCAG
TCTGCATTGCATATTTATATATTGATATTTATATAAATGCAAGAATAAGTGGTCTAGCAA
TTAAACTGGGTGTATGACAATGATTATTAATTCAGGATCATGGTATTGTGAGGAAAGATA
TTAATCTTATCTGTATGTCTTTTTAAAAATATGATGTAAATTAATACAAAACAAAATATG
GCCAGGCACTGGAGTTTCCTGACTAAATATTTTTACTTGGGATGAATCAGAAATGATCAA
ACTTAGGTGCTACCATTGTTGTAGAGTAGTTTAAGGCACTGCTTGTAATTGCTGGCATTT
CATATTGGAGGGCTGGTTGGAGGCCTGGCTACTCTGCTCCTGAACCAGATTCCAGCTAAT
GTGCCTGGGAAGGCAGTGGAAGATGGCACAAATACCTGGGTCCCTGACACCTAAGTAAAA
GAACCCAGATAGGGATCCTCACTACTGGCTTTGTCCTGGATACACACCTGGCTGTTGCCT
CTATTTGGCGATTAGACAAGCAGAAGAAAAATATCTCTGTCTCTCTCTCACTCTCTCTCT
TGCTTCCAAATAAATAAGTCAGTCTTAGGAAAAAATAAAAGACTAACCTCATGTCATAAT
CCTTGTGGGAGTCTTTTTCCATTCTCTGGCCATCACCTCCTTTATCTTTACCACAGGGAC
TATTCCTCAGCATTCAGTACAAATTAATCACTAGAACTCCTGTCACTGATTGAACACAAA
ATTCGGGGCTCCAATCATTACATGGAAGTTACACCTAAGAGACAGAAAAATGGGTTGCTT
ACTACTCCTTAATTATCAGTGAGTATGGGCTTGTTACTTTTTCTCTTGTCAGGACTCCTC
TTCGATCCCATATCTCTAGTCCCTGTAGGAACAGCTTCTGCTAGTAGAGGTACATGTTAA
CAAGAGGGGACAATTTTGAGAAAGGACATGAGGACCTACTACTTCATGGTGCCAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved