Oryctolagus_cuniculus Locus Mono:224:SNORD113
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:224:SNORD113
Oryctolagus_cuniculus
Mono:224:SNORD113
GeneScaffold_56
SNORD113
1001..1062
2062
GGCCTGGAAAGGTTAACAAACTTGCCCGTAGTATCTACAAACTCCTTTATACAATCCCA
CCTGGCGATATATATACCTTAAGCTCTAAACTGTAATGTGTATTTACCTCTAGGGTACAC
AAAGACTTTCAGGGGGTAGGGGAGATTTAACACCTGGAAATGTTTCAGTGGAATTCCCAT
GTCCTTATATCCTCTAAGATTGAGTTTGAGACGAGCCTGCATGTACAAAGCAAGTTCTTT
CTTTACACCATCTCTTTCACAAACTTTTATCTCATGTTATGAAATAAAGTTGAATCTTAG
TAATATGAAATATTAGTAAAAAAGGTCATTCCCAAAAGATTACAAACAGCATGATATCCT
GTTGTAAAATAAGAACTAAATTTGAAAACATAAGTTTTTATGAGAACATATAAATGGCAA
CAAAAAGTAAAGAAAGAAAGACACATACCAGAGATGATGATTACCTCAGATGGAAGGAGG
CAAGAGGATAGATGGGTGGGGGAAGGGGGTCATGATATGATTTTTTTTTTTTTTTTTTTG
ACAGGCAGAGTGGACAGTGAGAGAGAGAGACAGAGAGAAAGGTCTTCCTTTGCCGTTGGT
TCACCTTCCAATGGCCGCCGCGGCCGGCGCGCTGCGGCCGGCGCACCGCGCCGATCCGGT
GGCAGGAGCCAGGAGCCAGGTGCTTTTCCTGGTCTCCCATGGGGTGCAGGGCCCAAGCAC
CTGGGCCATCCTCCACTGCACTCCCTGGCCACAGCAGAGGGCTGGCCTGGAAGGGGGGCA
ACCGGGACAGAATCCGGCGCCCCGACCGGGACTAGAACCCGGTGTGCCGGCGCCGCTAGG
CGGAGGATTAGCCTAGTGAGCCGCGGCGCCGGCCTCATGATATGATTAATATAGGTTATT
TTCAAGGTTGTAGCTTTTGTCTGGTAGGTTCATGGCTGTTTATTAACATTATTTAAAATA
ACTAATTAAAGCAAGTGAAATAAATAAAAGAGAGCCATGCATGGACCAATGATGAGTGAC
ATAAGGATTATGATTAAACCAAGTCTATGCACCTGAGGTCCAAAAACAAAACAAAGGCAT
ACCTCTCAGCCATACTATGGTGCATTGCCTCAGCGTGTAAAAACCTCCTGGAGTAACAAA
CAAAGGGATATTTTAAAATATCGATAATGGGAAGATTTAAGGCATCATCAACCCACCAAA
GACTTTCCTTTCTGTGTGGATGTGTGTATTAGATGATGTGGGTCTCAGCCTCTATTGCGA
TACTTTGAAGTTAGATATATTGTAGTACCGCATAATGGGATAAATGAAATTATTTCATCT
TTTCAGTACCGATGGTCAGGGAATGCACTGTATTTATGGGAAAGCCCCATGATAACAAAG
CAAAGCCATCTATAGAGAGTGCCTTTTGCTCCCTCCCACAACGGAAAGGCAGGAAATTCT
TTAGGGATAACTTCATCATTGATCTCTAGGAAAGATAAACACTATTCTACAAAAAGCTAA
GGTAGTAACCGATGCCATTTTTTTAGATGTACCAGGAATGTTTTCCAAATGACTAGACTT
TTATGTGCTTTCTTGAAGGATTCAAATGCCAGCTCAGCCACTTACTTGATTTCCTTTAGG
TAAGTAACTTGACTTTGCGCCTCAATTTTCTTACCTTTACAAATGAGATGAATACTACTA
CCTGCCTCACAGAGCAGAGATATTATATGTTAACACACAGAAAAGCTTGGACAGTGTCAC
ACTGTAGACAACACATTCATGATTGACATAGTTGATCATCATTCAATAGGTAGCTTAGAA
CAGTTTTCATCAAATCATATCATGAAGTATTTATTCCAATGACAGCTATATTTCATATTA
CAGATTATTTAATCCTCCTTATATGGCTATTGAAAAATAAAATCAGAGGCTACCTGACAC
TTTTTAGCTTTAAAATTTTTTTTATGCTTTAAAATTTTTTTCATTAAATACATCAGAAAT
ATTTCACAGGACATCTAGTGCAATTAAAGGAGTTATTTGTGACTTATTTAATACTCTACT
CTCTTGGTCGCTTCAGCAGCACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved