Oryctolagus_cuniculus Locus Mono:78:SNORD57
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:78:SNORD57
Oryctolagus_cuniculus
Mono:78:SNORD57
scaffold_105078
SNORD57
1001..1071
2071
GTGCAATTCTTGATAGTGCTTTCTGCAGCTGTTGATTCTGCTTGATAGCTTTCCCTTTT
CTGATTTTTTTTTTTTCCCAATTTAAAGGCAGACTTTGAGAGGGAGAGGGAGAGAGAGGG
AGAGGGAGGGAATGACAGAGAGGGAGAGGTCTTCTATCTGCTGGCTCACTCCCCAAATGG
CGGCAGTGGCTGGAACCGGGTTGATCCAAAGCCAGGAGCCAGGAGCCTCTTCCTGGTCTC
CCATATGGATGCTAGGGCCCAGGTATTTGGGCCATCCTCCACTCCCTTCCCAGGTGTACC
AGAGGGAGTTATATAGGAAGTGGAGCAGCCGGGACTCCAACCTGGGCCCATATGGGAAAC
TGGCACTACCACTATACGTGGTAGCTTAACCAGGCACATTAGCAGAGAGCTGGATCAGAA
GAGGAGCAGCCAGGACAAGAACTGGTGCCCATATGGGATGCCAACACCACAGGCAGAAGC
TTAGTCGACTACACCATAGCATCAGCTCCAAGATAGTTTTTATATAGATTTGAAAATGGC
TGGCTTTTGTATGGTAGTGTTTGTTATAGCTTGTGTTAAAGTTGATGATCTTGCTGTGGT
GCAGCGAGTTAACGCCCTGGCCTGAAGTGCCGGCATCCCATATGGGTTCTGGTTCTAGTC
CAGCTGTTCCTCTTCCTATCCAGCTCTCTGCTATGGCCTGGGATATCAGTAGAGGATGGC
CCAAATCCTTGGGCCACTACACCCACGTGGGAGACCCAGAAGAAGCTTCTGGCTTCGGAT
CGGCGCAGCTCCGGCCGTTGTGGCCATCTGGGGAGTGAACCAGTGGATGGAGGACCTCTT
TCTCTGTCTCTGCCTCTCTCTCTGTAACTCTGTCTTTCCAATAAATAAAATAAATCTTAA
AAATAAAAGTTGATCTGGAATGCATGTGTGTGTGTGTGTGTGTGTTACATATATACACAC
ACAAACATGTTGGGAAAAAATTGATTAATGTAGTTCTTCTCTGGAAGTAATGAGCTGCTT
AGCCTGACCTTCTAGAGTGGAGGCAAAAAAACTGATTTAATGAGCCTGATCCAATAAAGC
CAACCAGGATGCCTTGGGTCTTCAGGCCTTTTCAACACGTTTCTATGACCAGGCAGAAGA
GGTGGCTGCCAAGATCACTAGAAAGCTGGAGAAGCAGAAGAAATGCTTGAAGAAGGAAAA
GAAGAGCTTGGCTGCATTCGCTCTGGCGTCTTCGGGAGACAGCACTACCCTTGAGGAGTG
ATGGGAGGTTCATGAAAAACCCAGAAAGAAGAAAAAGCAGAAGCCACAGGAGGCTCCTCG
GGAGAATGGAATGGAAGAACCATCTATCTCTTTCTCCAAACCCAAGAAAAAGGAAGCTTT
TTTCCAAGGAGGAGCTGGTTAGTAGTGATCAGAAGAGACAGGTGGCAGTGTAAGCCTCCC
AAGAAGAGACCCTAGGCCCGGGAGGAAATGGCAAATGATGCAGAAGAGGTGGGTAGCTAG
TTGGTCTCCAAGAAAAAGAGGAAATTCTCTTCCAGAGAGGAGCCTGTTAGCAGTGACCCT
GAAGAGGCTGCTGGCAGAGAAGAGCCGCACCAAGAACAAGAACAAGCTCTACAAAGCATC
CCAGGAAAATTAGCACGGACATTCTGCACCCCAAGGCAACCTTTACCAACTGTGGCCTCA
CCACAGTAAAAACAAATTTCATGCACCCCCCAAACCCCCACTTACATACAAAAGTAGTTC
TTCACTGGGGCTGGCGCTGTGGCATAGCGGGTTAAGCCACCTCCTGCAGCACCAGCATCC
CATGTGGGTGCCGGTTCGAGTCTCAGCTGCTGCACTTTCAACCCAGCTCCCAGCTAATGC
ACCTGGAAAAGCAGCAGCAGATGGCCTGCACCTGTTTGGGAGACTTGGCAGAAACTCCTG
GCTCCTGGCTTCAACCTGGCCCAGCCCTGGCTCTTTTGGCCATTTGGGGAGTGAACCAAT
GGATGGAAGACTTCTATCTCTTTGTCTCTGCCTCTCCCACTCTGTAACTCAATCTTTCGA
ATAAATACGTATTTTTTTAAACAAAGTAGTTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved