Oryctolagus_cuniculus Locus Mono:20:SNORD86
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:20:SNORD86
Oryctolagus_cuniculus
Mono:20:SNORD86
scaffold_194030
SNORD86
1001..1083
2083
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNGGGATGCTGGTGCCTCAGGCAGCGGAATTAACCCAAGTG
AGCCATGGCACCAGCCCCTCATTGTGCTTTTGATTTGCATTTTTCAAATGCCTAGGGATA
TTATGTATTTGTTCTTATATTTATTGCCCACTGTATTTCATCTCTTGCAAAATGTCTATG
CAAGTCCTTTGCCTATTTATTTAATGGGTTTATTCATTTTTTAAAAAGTTTGTTATATAT
TCTGGATATTAATCCTTTTTTGGACAACTAATTTGCCAATAAGTATTTTCTGTTGTTCTA
TTGCAAGTCTCTTTCAGTCCATTGATTGTTTCCTTTGTTGTGCAGAAGATTCTGAGTTTG
ACATACTCCTATTTGTCTCATTTTGCTTTTGTTTTCTGTGCTATTAAGATAGTATCCAAA
AAACTCACTACCTACATCTGTTTCTTGAAGTATTTTCCCTTTGTTTTCTTACAGCAATTT
CATGGTGTCAGGCTATTACATTTAGATGTTTGATCCATCTTAATTTTTATATTCAGTGAG
AGGTAGTGAAATAATTTCATTTTTTCCTACATATGTATATCCAGTTTTCCAGTAATCCTA
CTACTAGGTATATAGCCAAAAGATATGAAATCATTATATCAAAGATAGACTTGTATCACC
ATGATTATTATAGAACTATTAACAATAGCCAAGATATAGATGGGTGTCCATCATCAGCTG
AATGGATTAAAAATTGTGGCAGTTATACAAAATGAAATGTTAGTTATAAAAGCAATAAAA
TCCTCCCTGACCTGTGCAGGCCTCTGCTACAGGGGTGATGGCCGGTCCTGGTGTTTAGGT
GATTCCCAAGGCCCAGCAAGGGACCAAGTTTCCAGAGCCCTGAAGACAGAGGGTAACACA
CCCAACTAGGGGCTTCATTTCCGCTCCACCTTCATTGGCCGAGCCACCGCCAAGAACAGA
GGCCGCATCTCCCCATACCTGGCCAACAAATGCAGTGTTGCCTCACAAATCCATTGCTTC
TCTGAGGTACCCACAAGTGTATTTGGGGCGAAGCTACGAGAACAAGCTGAGGAGTGGCTG
ATCATCTATGAGGCTGGAGAGATTCCACGGAATCTCTGAGGGAAGCATGGTTCAGGCGGA
GCCGGCGGCTGCGGAGGTCACCAGGAAGCAGGAGAAGAAACGCATGAAGAAGGAAAAGCA
GCGCCTGGCGGCGCTCGCCCTGGCGTCATCGGGGAACAGCCCCAGCGCCCCGGAGGAGTG
CGAGGAGGCGCCGGAGAAACCCGGAAAGAAGCAAAAGCAGACGCCCCAGCAGGCTTCTCA
GAGTGGGATAGACTGGCAAGAGCAGTGCCGAGAGAAAAAAAAAAAAAAAAAAAAAAAAAC
AACCTCCATCGAGCATCCCAGGAAGACTGACTAGCACAGACATTCCCTGCACCTGCGAGG
GGTATCCTTTCCCGCCCTGTGTCCTCACCCCAATAAAAACGATACAAAATGTTAAAAAAA
AAAAAAAAGGGGGCAATAAAATTTTGTTATTCACAAAATGNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNTAGTAGTAGGCTATTGGCCCCAAAATATGCAGACATTTCA
CAAAGTTCATGGTAAATGGAATAAAAAGATAAGTTTATTTTGGTGCAAAAAATACTTTGA
ATTCTGTGCATTTGAAGGGTATTCAAGTAGTTCATGGTAAATTTGTATTTAAAAAAAATG
ATGGATTTAAAAAAAAAATTTGTACCAAAATAAAAATCTGAATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved