Oryctolagus_cuniculus Locus Mono:83:SNORA28
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:83:SNORA28
Oryctolagus_cuniculus
Mono:83:SNORA28
scaffold_69555
SNORA28
1001..1127
1638
TTAAGTATTAAATTTTTGGTTCCCGGCGTTTATGAAATTTACATATGTATCAGAATAGT
TTGGCGTTAATGAGTAATTCAAAATGTAAATGGTATAAACCACCACCATAATTCTCACAA
TTTTGTGTATTGCTGGGATGATTCCTTATTTGAGGTATTCTCAGCTGAGATTAGTGAAAA
ACTTAGACTATATGCACCTAAAATTTAATAAATCTGTTTAATAAGTTTCAATGAAAACAC
TACCGTGTAGATTTTGTCTGTAGAAATTATATGTCTCCATATGTATAAAATGGGCTTACT
TGTATTCTTTTAAATGAAGTTCATCTATATAAATATTAAAATACCATCTTTTATTGATAG
AATTTATTTAGAATAAATTTATTTGGCATTATCAAATATTTGTGAGACAGTCTAGTTAAT
AAAGTATGTATATATGTACACACATATATACCATTTATGGATTGCTAGTTTGCTAATTGA
AACATTAGTAATTGAAAGTAATATTCCATTGCAAGCAACACTCTGTGGCAGACTGTCAAA
ACCATCTGACACAATTTGAGCTTCCTATAGCAAGGAAGTCTAAACTGCTCCAGAAATCTC
TCTTCTGTTACACAAGCCATTATATTATACTTAAGCAGTGTTCAACAACAACAAAACAAA
ATAATATTTCAGCCAAGATATTGTTTCTTCTATGTACAAATACTCAAATTTTTACCAAAT
ACTAATTGTAAAAAACTATTACCAGGGGTGGGCATTTGGTGCTATGGTTAAGATACCAAT
TAGGGTGTTCATATTCCACTGAGAGGCTACGTTTGGGTCAGCTCCACTTCCAGTCCCAAC
TTCCTGCTAATGTACACTATGAGAGACAGTAGATGATGGCTCTAGTACTTGAGCTCCTGT
TACTCACATGGGGAGATTCAGATAAAGTTCTAGGCTCCTGGCTTCGGCCTGACCCAGCCC
TGGCTGTTGCAGGCATTTGGGAAGTGAACCAGCAGATGAGAGATCTCTATCTCTCCCTTT
CAAATAAATAAATACAATGAATCTTAAAAAAAACTTTTTTAAAAATCACCTGCCTCCCAG
GTATATTGCACAATAACAGAAAATGGAAGACGACAGCAACTTACAGTAGCTACTACCAAG
ACAAAAATTTGGAGTCAGAGAGTAGGCATCTGGTGCAAGAGTAATGTGTTCTTCTTGGGA
TGCATGCATTCCACATCAGAGTACCTGAGTTCAAGAGAACCTGCCACCCACGTGAGAGAC
CGGGATTGACTGGGCTCCTGGGTTCAGCCTGGCCCAGCCCCTACTGCTACAAGCATTTGG
AGAGTGAACCAGGGAATGGAAGATTCTCTATCCCCTTGCACCCCACCCCGCCTTTCAAAT
AAGTCTTTAAAAAAGAAAATACCACCTACCCAATCATTCCCCCTACCATGAATACTGTTC
CCTTGGATACCGGGGCCTCATTTCCCATCTACCACGGCGGCTGTTAATGATCAGTCTCCT
TTTCTGGGTCCTCTTTAATCTGCCAACCTCTAAGGACTCAAGGTTCAGTCTTCTGCCCCC
TCCTCTGTCTGTGCCCACTCCCAAGGTAGCCTGCCCACTCTTGTGGTTTTAAATAAACCA
ACAACTTCCAGATTAATGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved