Oryctolagus_cuniculus Locus Mono:98:SNORA70
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:98:SNORA70
Oryctolagus_cuniculus
Mono:98:SNORA70
scaffold_101988
SNORA70
1001..1127
2127
GGGATATGTAGGCTCAGCACGGGCTGCCCTCACCTCCAGAGAGGGCAGCAAAGTGGCTC
TACAGAACAGAGGGACGGGGTGGCTGTTTGGTGCCGTGGTTAAGATACGCTTAGGGTGCC
CACACCGCATATCCGGGTGCTTGGGTTCAAGAGCTGGCTCTGCTTCTGACTCCAGCTTCC
TGCTCAGGTGCACCTGGGAGCAGCAGGGGATGGCTCCAGTAGCTGGGTCCCTGACACGCG
TGTGGGAGACCTGGGTGGAATTCCCAGCTCTGGGGCGGCCAGCGTTGCGGCACAGCGGTT
AAGAAGCTGCTTGTGAAGTGCATCCATACTGGAGCACTGGGTTGATCCCTGGCTGCTCCA
CTTCTGACCCAGCTCCCTGCTAACACACCTAGAAAAGCAGCAGACGATGGCCCAAGTCCT
TGGGCCTCTGCACCCACGTGGGAGACTCAGATGGAGTTCCTGACTCCTGGTTTCAGCCTG
GGGTAGCCTTGGCCATTGTGACTATTTGGCGGGTGAACTAGCAGATAGAAGATCTCTTTC
TCTCTCTGTCACTCTGCCTTTCAAATAAATAAATAAATCTTAAACTTTTTTTTTTTTTTT
TAGATGAGAGGAGATTCTGACTTTGGCCTGGCCTAGCCTGGAAATTTGGAAATGAACCAG
TGTATGGGAGAAAATAAATAATCAACCAATCAACTAATCAATCAAAGGGATGAGAATTTG
AAACTTGGGAGGAGACACTGTTGGAGGAAAGGAGGGAAGAGGTGAGGAGAAGGCAGAGAG
AGTGGGAAGAGGAATCTACAAGGGCGGGGGGAAGCTGTGTACAGTATAATGTAGCCCCTC
CTTGTAGCCCTGAAATCTTCACCAAGACTCCTGAAGCTCATGAAATGCTTCATGGGAGAG
AGTACGTGTATGTGGATCACATGCTTGTGTATACAATCCCTGGGTGGATTGTCTAGGAGT
AAACCCGGGACAGCAAGAGGGCATGATGAGGAAGTGAGCCTTGGCATGTCTCAGAAATCA
CAGATCAGCTCGGGGCCCCAGTGTGCAACAGCTGCAAATGGCAACCTCCTCCATGGTGTA
TACAGCCTGCTGCTTGTATGGCAGCCTTCAGGGACCTTGGGGACGGTCCTTTCCATTGGA
CCTTGGTGTCTGAGATGTTGTGTTGTTCCCAAGTTTGATTCCAGCCAGCCATGGGGGTGC
CTTTGGAAAACCCTGTGTCACAGTGGCCAGGGTTCACATTGCTCAAGTCAGCTTGGGCAT
CTGCACCAAGCTGCAGAACAAGGAGCATGTAATATATGCAAAATTCAAATTAGTTTGTCA
GCTCCTCATTTCTGGTCTGAATTTTGACTTGGATATATTATGATTCAAAGTATTTAATGA
CTGCATAGGTTAATTTCACAAACAAGCTGTCTTTAAAATGTCAGCTTTAGGAGTGTGTTT
GGCATAGGGCTTAAGCTGTCCTTGGATGCCGTGTTCCGAATAGGTTCCTACCTGCTCTGC
TCCGATTCCAACTTCCTTTAATTACACTCTTGTATGTTTTTCTATTTATTGTTCTTTTTT
TTGTTTTTTTCTTTTTCTTTTTCTTTTTGAAAATCTGGACCTCCTCTCTTTCTTTTGTTT
TTTGTTTGTTTTTGTGTATTTATTTTCTTCAAGAAAACACCTTTTCTTTCTTCCCTTTTA
AATTAAAAAAAATTATATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved