Oryctolagus_cuniculus Locus Mono:123:SNORD14
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:123:SNORD14
Oryctolagus_cuniculus
Mono:123:SNORD14
scaffold_143217
SNORD14
1001..1089
2058
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCCTCCTGCTATGATGAGTGATCC
TTAACCAATTTGTAGTTTCCACCAAAAGCTTGGCTAACAAATGGCATACCTTCCTTGGAT
GTATGAGCGACTCAGCTTGGTTAAAGAAAAAAAAAACATAACTTGTCCTCTTTCCCCGAC
TATGTGTCAAAATCTTACATATCCTTGAAAGCCGATTTTAAATGACAAGAGAAGCCTTCT
CTGCCCACCCTCTCCCAACTGAATACAACCTTTATCCACATATCTCATTACCAACATTTT
TCAGCATCACTTTCTACCTTCTTGTGTATTTATGTGTGTATTTTTATCAGAAAGACAGAT
ATTTTTATGAGAGCAGGAACTAATGAATTTCTCACTTCCTGCTGGCCCAGCTAATAAATA
CGGGATAAGTTGCATGGAATGAAATACTTCTGCCCAGTTCATCTGACTCAAACAACCCAC
AGAATATTTCTTGGTCCTAAAGTTAAAAAGGAAACCTCAAAAAAAAAAAAAAAAACACAT
ACACACACAAATGTCACCTCCTACTTCCTGTCTCCCTCCTTGGGACTCAGGACAAGCCTG
AAATGGCCCTGTCTGAATTGGTTTTCTTTGGCTATAGCTATGACAAGACCTGAGATGTGG
GTGGGGAAAAAAAATAAAGTGTTCAAATCTGAAAAACAATAAGAAGTTTTGGTATGAGTC
TGAAATTCGTGATGCAGACACATTCATCCCCATTTTATTTGTTCAGCAAACTTCTTTTTG
TAAGACAACCCAGAATGGAGATTCAGAATCTGGGATCCAGACAAAGCTGAGGTCTTTGAT
ACCTGATAACTGAAGATGGATATATACACAGCTTAGTTTAGCATTCAGAGTTCTTGGGGT
TCCAATCCATGCTTCTCATCATCTTTGACTCAGTTCTACCCAGTGAACATTTGTCCTGCC
TGCCCTGCACTCGGCAACTGGAAAAGCATTAGAAGTCTCAGGATGGAGAAGGTTCAGGCC
TTTCCTTTGAGAGGGACAACATTTGGTGGCTATCAGGAAGGAGCGATAACATACTAAACA
GGAAAGAAAGAAGGTGGAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved