Oryctolagus_cuniculus Locus Mono:26:SNORA51
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:26:SNORA51
Oryctolagus_cuniculus
Mono:26:SNORA51
scaffold_211290
SNORA51
1001..1130
2130
CCTCTCTCTGTTGCTCTGCCTTTCATATAAAATAAATATAGATTTTTTTAAACGTCACT
TGTTACTTCTCGCAATCCATTGGGTAAAACTGGTCTCGTAGCCCCACCTAGCCTCCAGGG
ATTCAGGAAGTGCAAGCCTGTTTGCCTGGAAGGCAGCGAGCTGGAAGTATTTGGTGACCT
GCTCCAGTGACTCCCACACTGGCCTCCACTAATTCCTCAAACAAGACAAGCTGTTTGTTG
CCTAAGAACCTCCACCCCTTCTTCCCTTGGTCCCTTGTGTCCCTTGTGTCCATTGCCTTG
TGCCTTGGCCAGTTTCTGTCTGCCTTTGGCTGTTAGCGTCAATGATCTTTCCAAGAGGCT
CTCTGTGATTTCATTATGGTGTAAGTTCTCCTCTGAGACTCTCTCCTAAATCTCTATGAT
TTTTTTATTTGTAGTTATTGAGATTTGAAGAGTAACAATTTTTTTTAACGAAAAACTTTT
TTAGGCTTATTTATTTGAGAGGGATGGGGTGAATAGGCGAGCTCCCCTCTGCTGGTTCCT
TCCCCAAATGCCCTTAATGGTCAGGGCTGAGTCAGGCTGAAGCCAGGAACCAGGGACTCC
ATCCAGGTCTTTCCTGTGGGTGGCAGGAATCCAGTCACTTGAGCCATCACCACTGCCTCC
CAGGGTCAGCATTGGCAGGAAGTTCGAATCAGGAACTGGAACCTGCTGTTGTGTACCCAG
GCACTCGACATGGGACATGGGCATTGTGACAGCCAGGCTAAATGCTCATTCTGTAACACT
TCTTTCTCTCCTTTTTGAGTTCAGAGCCAGCTGAAAGTTTGGAAGTAGATGAACGAGGGA
TCAAAATGTCACCTTGCCAGCCTGGATTGGAGGGCATGGCCCCTGATTTAAATTTACCTA
CTGTAGGTCTCTGGCACACATGGGAGTTGCAGGCTTGTTCCCAAGGGACAGTGGGTACAT
ACAGTCCTTTGGACAAATCGACTTTGGAAAGAGAGTAAATTGGCCTCCTGGTGCTTACTA
CAGGCTGTATTCTTGCACTGACTGTAAAGAAAGAGGCAGAGAAGACCCTCCCTATGTACA
CCTCAGCTCAGGCCTCGTATATGGGCTGTATTGTGAATGGGGGGGATAAGGAGAAAAAAA
AAGAAAAAAGAGAATAAATTGCCAAGATTGGCGCCCACTCCTCTTTGCAAGGGGTAAATG
AGAGATGGAGAGAGAGGACAAAATAGTTTAAGAAATATCGGCTCATGGAAAAACTGAGGC
CAGGGACATGGCCATTCCAATAGAATTTATTTCAATTTATTATTCTATATTCCTTGTGTA
ATTGTGTATTATTTTATTTTAAAGTTCTGTTTTCCCCACCAAAAGTTAAGCATCAAGAGA
GTAGGAAAAAAATAAGTCTTTGGTTCTCCCCTGTATGCACAGCACCTTGCGATGGTACAT
GGGAGCTCCTGGCGGAGTCCTCCTGGACCCACTGGGTTCTGTCAGAGCAGAATGTCTGAC
AGTTGCATACAACTTCACCCTTATGCTGAAGCCTCTTTTGCACTCAGAACGTCCACAAAA
CTTACAGGATCCTAAAGCAGCCGGGGTCCTTAGGAGTCATCTATGTCAGGCCCCCCTCCC
AGTATGGGAACCTGCTTGGCAGCATCTTCGCTATGTAAATGCTGACAGTCATGGTGTCTG
GAGCACTGCTGGTTGAACATTGTGAACTGCTGCTTGAATATTGTGGTCATGAAACTTGGA
AAGCAGTTTTCACCAACCACAGGGATCTGAGGGAAGGATACCCAGATAGGGAGAGTCCTG
AAATTGTTTCATGGAGAAGAGCAGAATAAACTGGATTATTTATCTCTAGTGGTGTGGATT
GGGGAGGGTGGGGGAAGACCATAAGAGTATGAATAGGAGCCTCCAAATAGTTGTGCAACT
GTCACATGGGAGAGTTGACTTATTTTGTAAGTTTTGAGGTCAGAGCTGGGGTAATGGTTA
AAAATGAGAGAAGAAGATGCTATATTTAAGGAAGTGCTTTGTGAAGTTAGAGTTATTTAT
CAATAAGACAGTTGGCTTAAAAGTATAACTGAAGTTCCTGCACTCAACGTGTATTTAATG
TTTACTAGGTGCAGAACACTCTGCTACGTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved