Oryctolagus_cuniculus Locus Mono:128:SNORA18
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:128:SNORA18
Oryctolagus_cuniculus
Mono:128:SNORA18
scaffold_85591
SNORA18
1001..1132
2132
CATATCTCAAATTCTTTTAAGAACAAGTGATCAAAAACACTTAAGAAAAACATATGAAA
AAATGTGACACTCTCCCTTCAAACCACTGTACTAAGTTAAAGAGTTCCATAATTTACAAA
TGCAAAGGACTTAGAATAGTCAACTTAACTTTAATAAGAATAACAAATAATGAAGGACAT
ATATTTCCTGATGTCAAGGTTTGTTATAAAACTATGGTGATCAAAACAGTATGGTACTGA
CCTTAAAGCAGACATACAGAGTCATGGTGCCACATAACAATGTTTCAGGCAATAATAAGC
CACACATACAATGATGGTCCCTTAAGATAGCTATCACCTAGTAACATCAGAGCTTTCTGA
GTTTGTGTAAGTACAGTCTGTGATGTTCAAATAAAGAAGAAATTGCTGGAGCTTGCACTA
TGGTGTAGTGGGTAAAGCCACCACTTGCAAATACCAGCATTCCATCTTGGTTCCAGTTTG
AATCCTGGATGCTCCATTTCTGATCCAGCTTCCTGCTAACATGCATGAGAAAGCAGTGGC
AGAAGGCACAAGTGCTTGGGCCACTGCGCCTATGTAGGAGGGTGGGTGGAAGCTCCTGGT
TCCTGACTTTGGATCAGCCCAGCTCCAGCCCTTGTAGCCATTTAAGGAGTGAATCAGCAG
ATGGAAGATTCTCATTCTGCCTTTCAACTAAATAAATATATCTTAAAAACAAACAAACAA
ACAAACAAACAAAAAAAACAAAACAAAAACCACACACAATGAAATTTCCTGTCAACAGAT
CATTCAATACAATGAGGGCATAGAGTTAGGAAGTGGACTCACTTCATTTTAAACAAAGAT
GCAAATAGGAAAAGGTTATCTTCCAAAAGATTGATGCTTGGAACAAGTAGATTCTCATAT
GGGAAAGAAAAAATTGAACTTCAGCCTTTATTTTCCTCACACTCTAAATAAAAATTAACT
TGAAATGGCTTATAAATCTATACGTAAAATACACAACTATTGCCTAGGTCTATGCCAACA
GGGCTTTTCCCACAGACGCTCGTCATTGGAAACACCTCATAGAATATTTCTGTGGTTTTG
CTTTCCTCACAGGACTTTGTTTTAGGTCTGTGTGAAGGAATTATAAGATAATTAAAAATA
TATACATACAACTATTACAATCATGAGAGAAAGCACTGCAGAAAAATCCTGACAACTTTG
TGGACGGCAAACATTCCACAAGACAGGAAATTTTAAAAAACTGATAAACAGAAACTTATC
CAAACTAAATACCTGTTTTCTCTGAAAGACACCATTAAGAAAATTTACAAAAGGCTAGAA
GAAAATATTAGCAATACATATATCTGAAAAAAATCTGTATCTAAAACATACAAAGAATTC
TCATGATTAAATAACAGTAAGAGCTGATTTAATAACTGGCAAAAATAGACACTTTACAAA
ATGTACACAAATGGCAAGTAAATATATTAAAGGGACAAGGGAAAAACAGAAAAATGATAA
GGAAATATCAGTAACATATCTACTATAGTATACACTTTCTGATATTAAAAGGATGACAGT
GGCAAGAATTATTGAGGATTTGAGGCAACCTAATTTTCTTACACGGCTGATGGGGACGCT
AAAAGGCAACCACTTTGGAAAACATTTGGGCAGCTTCTTAATATGTTAAATACACCCTAA
TCATAAAACTCATCACTTCCAATTCCAGGTATTTATATACAAGAAATAAATATAAACACA
AATATCCAAAATGACTCGCATGTGAACATTCCTAAGTTTATATAAAAGTCAAAGAGTGTA
AACAATTCGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved